WormBase Tree Display for Variation: WBVar00144281
expand all nodes | collapse all nodes | view schema
| WBVar00144281 | Evidence | Paper_evidence | WBPaper00003948 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1752 | |||||||
| Other_name | Y41D4B.13a.1:c.459G>A | ||||||||
| CE28360:p.Trp153Ter | |||||||||
| HGVSg | CHROMOSOME_IV:g.1600197G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y41D4B | |||||
| Flanking_sequences | tttttttccagcaaaaacgaaccaggattg | tgggaggcgagaaacgcgttgggaaccact | |||||||
| Mapping_target | Y41D4B | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004459 | ||||||||
| WBStrain00004482 | |||||||||
| WBStrain00027172 | |||||||||
| WBStrain00027173 | |||||||||
| WBStrain00027276 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000416 | |||||||
| Transcript | Y41D4B.13a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y41D4B.13a.1:c.459G>A | ||||||||
| HGVSp | CE28360:p.Trp153Ter | ||||||||
| cDNA_position | 461 | ||||||||
| CDS_position | 459 | ||||||||
| Protein_position | 153 | ||||||||
| Exon_number | 3/5 | ||||||||
| Codon_change | tgG/tgA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000052081 | ||||||||
| WBInteraction000052084 | |||||||||
| WBInteraction000052380 | |||||||||
| WBInteraction000052381 | |||||||||
| WBInteraction000517331 | |||||||||
| WBInteraction000519066 | |||||||||
| WBInteraction000519083 | |||||||||
| WBInteraction000556871 | |||||||||
| Genetics | Interpolated_map_position | IV | -16.5924 | ||||||
| Mapping_data | In_2_point | 645 | |||||||
| In_multi_point | 578 | ||||||||
| 2437 | |||||||||
| Description | Phenotype (5) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000188 | Paper_evidence | WBPaper00003948 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Gonadal arms were as long as those in wild-type animals; germ cells were organized properly as well. | Paper_evidence | WBPaper00003948 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000520 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | no gross phenotype | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001656 | Paper_evidence | WBPaper00003948 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Initiating and maintaining a trajectory is normal. | Paper_evidence | WBPaper00003948 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002486 | Paper_evidence | WBPaper00050421 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Mutations in genes within the ced-1/6/7 pathway (ced-1, ced-7, nrf-5, ttr-52), the ced-2/5/12 pathway (ced-2, ced-5), or both pathways (ced-1;ced-2 and ced-7;ced-5) did not cause PGC lobes to persist in L1 larvae (Supplementary Table 1), indicating that ced-10 functions in PGC lobe scission in a different context than it does in cell corpse engulfment." (PGC = 'primordial germ cell') | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004576 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0004575 | PATO:0000460 | Paper_evidence | WBPaper00050421 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | All strains include the xnIs360 or xnSi1 transgenes to visualize PGC membranes. | Paper_evidence | WBPaper00050421 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference (12) | |||||||||
| Remark | This substitution allele is coupled with a downstream mutation [G192 to E] | Paper_evidence | WBPaper00003948 | ||||||
| Method | Substitution_allele |
