WormBase Tree Display for Variation: WBVar00144274
expand all nodes | collapse all nodes | view schema
| WBVar00144274 | Evidence | Paper_evidence | WBPaper00005969 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1744 | |||||
| Other_name | T22C8.8.1:c.497delinsA | ||||||
| CE32938:p.Trp166Ter | |||||||
| HGVSg | CHROMOSOME_II:g.8636627delinsT | ||||||
| Sequence_details | SMap | S_parent | Sequence | T22C8 | |||
| Flanking_sequences | acggtagccgcaggaactgggaagttgatt | tcatatggtattgcatggggagcaacactt | |||||
| Mapping_target | T22C8 | ||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00005969 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004468 | ||||||
| WBStrain00007740 | |||||||
| WBStrain00007742 | |||||||
| WBStrain00007743 | |||||||
| WBStrain00045503 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006875 | |||||
| Transcript | T22C8.8.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T22C8.8.1:c.497delinsA | ||||||
| HGVSp | CE32938:p.Trp166Ter | ||||||
| cDNA_position | 540-541 | ||||||
| CDS_position | 497-498 | ||||||
| Protein_position | 166 | ||||||
| Exon_number | 5/6 | ||||||
| Codon_change | tGG/tAG | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | II | 0.829666 | ||||
| Mapping_data | In_2_point | 620 | |||||
| 626 | |||||||
| In_multi_point | 537 | ||||||
| 548 | |||||||
| 549 | |||||||
| 707 | |||||||
| 708 | |||||||
| 1295 | |||||||
| 1441 | |||||||
| 1467 | |||||||
| 1476 | |||||||
| 2072 | |||||||
| In_pos_neg_data (17) | |||||||
| Description | Phenotype | WBPhenotype:0000452 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | tail whip knobbed at all stages except adult male | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000506 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | adult male tail tip slightly swollen | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | slightly dumpy, easy to score (ES3) in larvae. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | variably Egl | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00014137 | ||||||
| WBPaper00032446 | |||||||
| WBPaper00020813 | |||||||
| WBPaper00012425 | |||||||
| WBPaper00014619 | |||||||
| Remark | e1744 is either a W(166) to opal or W(166) to amber nonsense mutation. | Paper_evidence | WBPaper00005969 | ||||
| Method | Substitution_allele |
