WormBase Tree Display for Variation: WBVar00144248

WBVar00144248 Name: Public_name: e1715
    Other_name: F16F9.5.1:c.314C>T
      CE09444:p.Ser105Phe
    HGVSg: CHROMOSOME_X:g.8469880G>A
  Sequence_details: SMap: S_parent: Sequence: T01B10
    Flanking_sequences: ggcatttacaacagttttgctataaaacat tagtcatggtattccaatgcttgggcaagc
    Mapping_target: T01B10
    Type_of_mutation: Substitution: C T Paper_evidence: WBPaper00002482
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00003174
    Transcript: F16F9.5.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: F16F9.5.1:c.314C>T
        HGVSp: CE09444:p.Ser105Phe
        cDNA_position: 388
        CDS_position: 314
        Protein_position: 105
        Exon_number: 3/19
        Codon_change: tCt/tTt
        Amino_acid_change: S/F
  Genetics: Interpolated_map_position: X 0.0292771
  Description: Phenotype: WBPhenotype:0000456 Paper_evidence: WBPaper00000502
          WBPaper00040149
        Curator_confirmed: WBPerson712
        Remark: On average, mec-10 mutant animals respond only to 1-4 touches of 10, whereas wild-type animals respond to 9 touches of 10. Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00000502
          Curator_confirmed: WBPerson712
        Variation_effect: Hypermorph_gain_of_function: Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
      WBPhenotype:0002028 Paper_evidence: WBPaper00040149
        Curator_confirmed: WBPerson712
        Remark: Mutants have MRCs with a dramatic reduction in peak MRC size compared to wild-type. Touch receptor neuron respond to applied pressure stimulus. Mutations in MEC-10 shifted the reversal potential for MRCs by -40 mV or more. Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
        Variation_effect: Hypermorph_gain_of_function: Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005490 PATO:0000460 Paper_evidence: WBPaper00040149
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000436 Paper_evidence: WBPaper00040149
        Curator_confirmed: WBPerson712
        Remark: The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040149
    WBPaper00000502
  Method: Substitution_allele