WormBase Tree Display for Variation: WBVar00144151
expand all nodes | collapse all nodes | view schema
WBVar00144151 | Evidence | Paper_evidence | WBPaper00000502 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1612 | |||||||
Other_name | F01D4.6c.1:c.555+1G>A | ||||||||
F01D4.6a.1:c.684+1G>A | |||||||||
F01D4.6d.1:c.633+1G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.10460123C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F01D4 | |||||
Flanking_sequences | ggacctagaacgacaatcaaacaaaatcag | tatacaatgtaagaaagcggaaattttcat | |||||||
Mapping_target | F01D4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001793 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003167 | |||||||
Transcript | F01D4.6d.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6d.1:c.633+1G>A | ||||||||
Intron_number | 6/8 | ||||||||
F01D4.6c.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6c.1:c.555+1G>A | ||||||||
Intron_number | 4/5 | ||||||||
F01D4.6a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6a.1:c.684+1G>A | ||||||||
Intron_number | 7/9 | ||||||||
Genetics | Interpolated_map_position | IV | 4.59777 | ||||||
Mapping_data | In_multi_point | 418 | |||||||
3188 | |||||||||
3238 | |||||||||
3239 | |||||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mechanosensory cells remain small and do not have processes. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ALM cells more lateral than in WT | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000502 | ||||||||
WBPaper00001793 | |||||||||
Method | Substitution_allele |