WormBase Tree Display for Variation: WBVar00144146
expand all nodes | collapse all nodes | view schema
WBVar00144146 | Evidence | Paper_evidence | WBPaper00046013 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | C44B11 | ||||
Flanking_sequences | ggattcctagtgttccactctttcggagga | gtactggatccggtttcacttctcttttga | ||||||
Mapping_target | C44B11 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00046013 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003175 | ||||||
Transcript | C44B11.3.1 (11) | |||||||
Interactor | WBInteraction000504762 | |||||||
WBInteraction000517361 | ||||||||
Genetics | Interpolated_map_position | III | -7.50264 | |||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | ||||
WBPaper00037771 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson209 | ||||||||
Remark | e.g. Figure 5G | Paper_evidence | WBPaper00037771 | |||||
Curator_confirmed | WBPerson209 | |||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Weaker allele than e1605. | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
weaker allele than e1605 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Dominant | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00038206 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited reduced fluorescence in GFP-expressing touch receptor neurons (TRNs). | Paper_evidence | WBPaper00038206 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | uIs22(Pmec-3::GFP) | Paper_evidence | WBPaper00038206 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001676 | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Touch cell processes have fewer or are missing large diameter microtubules compared to processes in control animals. | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001933 | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The pattern of jsIs821[RAB-3::GFP] localization was disrupted; reduced or abolished and nearly indistinguishable from mec-7(u443) animals. Homozygous mec-12(e1607)animals had a Sam phenotype nearly indistinguishable from mec-7(u443) animals. However, the cell bodies in these mutants were often larger and more intensely fluorescent than those observed in mec-15 mutants. mec-12(e1607) heterozygous animals had Sam and cell-body defects. | Paper_evidence | WBPaper00035070 | |||||
Curator_confirmed | WBPerson712 | |||||||
Dominant | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038206 | |||||||
WBPaper00000502 | ||||||||
WBPaper00001125 | ||||||||
WBPaper00035070 | ||||||||
WBPaper00037771 | ||||||||
WBPaper00046013 | ||||||||
WBPaper00045955 | ||||||||
Method | Substitution_allele |