WormBase Tree Display for Variation: WBVar00144072
expand all nodes | collapse all nodes | view schema
WBVar00144072 | Evidence | Paper_evidence | WBPaper00002018 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1522 | ||||||
Other_name | ZK154.3.1:c.949T>A | |||||||
CE15257:p.Phe317Ile | ||||||||
HGVSg | CHROMOSOME_X:g.7775395A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK154 | ||||
Flanking_sequences | caacctccttcatgctcattcttcctcgga | aatggcagcagcggtgagataacgtccatg | ||||||
Mapping_target | ZK154 | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003171 | ||||||
Transcript | ZK154.3.1 (11) | |||||||
Genetics | Interpolated_map_position | X | -1.27626 | |||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00000550 | ||||
Curator_confirmed | WBPerson95 | |||||||
Remark | Mutants heterozygous (but not homozygous) for mec-7 alleles e1505, e1343, e1522, and e1527 have a temperature-sensitive Mec phenotype, i.e., they are temperature sensitive dominants. Temperature-shift experiments with e1343/+ and e1522/+ heterozygotes suggest that mec-7 is needed throughout larval development for adult touch sensitivity. | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | |||||||
Dominant | Paper_evidence | WBPaper00000550 | ||||||
Curator_confirmed | WBPerson95 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | |||||||
Phenotype_assay | Genotype | e1522/+ | Paper_evidence | WBPaper00000550 | ||||
Curator_confirmed | WBPerson95 | |||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Touch cells lack large specialized microtubules. | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00000502 | |||||||
WBPaper00002018 | ||||||||
WBPaper00000550 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |