WormBase Tree Display for Variation: WBVar00144062

WBVar00144062 Evidence: Paper_evidence: WBPaper00004737
  Name: Public_name: e1511
    Other_name: e1151ts Paper_evidence: WBPaper00004737
      R12B2.4.1:c.325C>T
      CE01367:p.Pro109Ser
    HGVSg: CHROMOSOME_III:g.5803686C>T
  Sequence_details: SMap: S_parent: Sequence: R12B2
    Flanking_sequences: ctggacttgacgatgtgcgatctcgtgaca ctgcaaaacacgaacatcgattcagaaagc
    Mapping_target: R12B2
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004351
      WBStrain00034377
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001869
    Transcript: R12B2.4.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: R12B2.4.1:c.325C>T
        HGVSp: CE01367:p.Pro109Ser
        cDNA_position: 330
        CDS_position: 325
        Protein_position: 109
        Exon_number: 4/8
        Codon_change: Cct/Tct
        Amino_acid_change: P/S
  Genetics: Interpolated_map_position: III -1.44566
    Mapping_data: In_multi_point: 218
        324
        863
  Description: Phenotype (3)
    Phenotype_not_observed: WBPhenotype:0000143 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
      WBPhenotype:0000276 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
  Reference: WBPaper00000565
    WBPaper00026374
  Method: Substitution_allele