WormBase Tree Display for Variation: WBVar00144062
expand all nodes | collapse all nodes | view schema
WBVar00144062 | Evidence | Paper_evidence | WBPaper00004737 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1511 | ||||||
Other_name | e1151ts | Paper_evidence | WBPaper00004737 | |||||
R12B2.4.1:c.325C>T | ||||||||
CE01367:p.Pro109Ser | ||||||||
HGVSg | CHROMOSOME_III:g.5803686C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | R12B2 | ||||
Flanking_sequences | ctggacttgacgatgtgcgatctcgtgaca | ctgcaaaacacgaacatcgattcagaaagc | ||||||
Mapping_target | R12B2 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004351 | |||||||
WBStrain00034377 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001869 | ||||||
Transcript | R12B2.4.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | R12B2.4.1:c.325C>T | |||||||
HGVSp | CE01367:p.Pro109Ser | |||||||
cDNA_position | 330 | |||||||
CDS_position | 325 | |||||||
Protein_position | 109 | |||||||
Exon_number | 4/8 | |||||||
Codon_change | Cct/Tct | |||||||
Amino_acid_change | P/S | |||||||
Genetics | Interpolated_map_position | III | -1.44566 | |||||
Mapping_data | In_multi_point (3) | |||||||
Description | Phenotype | WBPhenotype:0000154 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | low brood size at 25C | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000351 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | many unhatched eggs at 25C | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000565 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male self-progeny make up 12% of the population as measured from 8 broods, 1270 total animals. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | |||||||
Self-progeny 2% XO male (15C) 12% male (20C) 27% male (25C). Probably some chromosome loss in premeiotic germ-line: abnormal mitotic cytology, jackpots in male production. Easy to score (ES3) in progeny at 25C. Mating successful (ME3) at 20C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000143 | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000276 | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00000565 | |||||||
WBPaper00026374 | ||||||||
Method | Substitution_allele |