WormBase Tree Display for Variation: WBVar00144042
expand all nodes | collapse all nodes | view schema
| WBVar00144042 | Evidence | Paper_evidence | WBPaper00002482 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1494 | |||||
| Other_name | CE05481:p.Gly315Glu | ||||||
| C50H2.3a.1:c.944G>A | |||||||
| HGVSg | CHROMOSOME_V:g.9913052C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C50H2 | |||
| Flanking_sequences | gtacttgtctagaaggatacgcaggaaatg | atataactgtacagtttctaaaagtcagcg | |||||
| Mapping_target | C50H2 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002482 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004348 | ||||||
| WBStrain00006234 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003173 | |||||
| Transcript | C50H2.3a.1 (12) | ||||||
| Genetics | Interpolated_map_position | V | 2.21131 | ||||
| Mapping_data | In_2_point | 133 | |||||
| In_multi_point | 284 | ||||||
| 3103 | |||||||
| 3104 | |||||||
| In_pos_neg_data | 495 | ||||||
| 1747 | |||||||
| 1751 | |||||||
| 3124 | |||||||
| 3125 | |||||||
| 3126 | |||||||
| 3127 | |||||||
| Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Recessive | Paper_evidence | WBPaper00000502 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00030928 | |||||
| Curator_confirmed | WBPerson48753 | ||||||
| Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
| Curator_confirmed | WBPerson48753 | ||||||
| WBPhenotype:0002592 | Paper_evidence | WBPaper00030928 | |||||
| Curator_confirmed | WBPerson48753 | ||||||
| Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
| Curator_confirmed | WBPerson48753 | ||||||
| Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00000502 | ||||||
| WBPaper00003680 | |||||||
| WBPaper00003408 | |||||||
| WBPaper00030928 | |||||||
| Method | Substitution_allele |
