WormBase Tree Display for Variation: WBVar00144038

WBVar00144038 Evidence: Paper_evidence: WBPaper00026986
  Name: Public_name: e1489
    Other_name: T07G12.12a.1:c.775G>A
      CE36715:p.Gly259Arg
    HGVSg: CHROMOSOME_IV:g.10563247G>A
  Sequence_details: SMap: S_parent: Sequence: T07G12
    Flanking_sequences: aatcgagcaattgcgtggaagaggaaatat gaaaacttcgtcttatcgatcacgcattgg
    Mapping_target: T07G12
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00026986
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (127)
    Laboratory: CB
      NFB
      OH
      CHB
    Status: Live
  Affects: Gene: WBGene00001867
    Transcript: T07G12.12a.1 (12)
  Genetics: Interpolated_map_position: IV 4.63927
    Mapping_data: In_2_point: 317
      In_multi_point (12)
      In_pos_neg_data: 961
        968
        969
        4251
        4689
  Description: Phenotype (5)
    Phenotype_not_observed: WBPhenotype:0000050 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: 0.8% eggs never hatch, yet are refractile, similar in percent to those from wild type animals. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
        Remark: Animals produce 4% dead embryos and L1 (n=1597), not unlike wild type, which produce 2% dead L1 (n=1755). Paper_evidence: WBPaper00001077
            Curator_confirmed: WBPerson712
      WBPhenotype:0000143 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals have an average brood size of 30237 s.d. (6 broods counted), wild type has average brood size 33034 s.d. (8 broods counted). Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0000276 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
      WBPhenotype:0000517 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals are indistinguishable from wild type in terms of behavior. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0000520 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
        Remark: Average brood size 254 38 (n=1597) Paper_evidence: WBPaper00001077
            Curator_confirmed: WBPerson712
      WBPhenotype:0001631 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0002140 Paper_evidence: WBPaper00032050
        Curator_confirmed: WBPerson712
        Remark: Males responded to ascr#3, an ascaroside, in male attraction assays. Paper_evidence: WBPaper00032050
            Curator_confirmed: WBPerson712
  Reference (29)
  Remark: Allele incorrectly cited as e1389 Paper_evidence: WBPaper00003393
    Allele incorrectly cited as e2489 Paper_evidence: WBPaper00003294
    Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Substitution_allele