WormBase Tree Display for Variation: WBVar00144014
expand all nodes | collapse all nodes | view schema
WBVar00144014 | Evidence | Paper_evidence | WBPaper00003888 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1457 | |||||||
Other_name | T09A5.10.2:c.119G>A | ||||||||
T09A5.10.1:c.119G>A | |||||||||
CE18951:p.Gly40Glu | |||||||||
HGVSg | CHROMOSOME_II:g.7860778G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T09A5 | |||||
Flanking_sequences | gctcattagccgagctttgggagaggcacg | gagtatgatcgccagtatgatgtaagtaat | |||||||
Mapping_target | T09A5 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034592 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002994 | |||||||
Transcript | T09A5.10.2 (12) | ||||||||
T09A5.10.1 (12) | |||||||||
Genetics | Interpolated_map_position | II | 0.586591 | ||||||
Description | Phenotype | WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | phenotype similar to e1348 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000417 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All postembryonic divisions fail from defective cytokinesis although DNA replication continues, phenotype similar to e1348. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000022 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000434 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No sexual maturation in either sex, phenotype similar to e1348. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Uncoordinated after L1, phenotype similar to e1348. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000035 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | phenotype similar to e1348 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000433 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All postembryonic divisions fail from defective cytokinesis although DNA replication continues, phenotype similar to e1348. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00024244 | ||||||||
WBPaper00023128 | |||||||||
WBPaper00010599 | |||||||||
WBPaper00018632 | |||||||||
Method | Substitution_allele |