WormBase Tree Display for Variation: WBVar00144008
expand all nodes | collapse all nodes | view schema
WBVar00144008 | Evidence | Paper_evidence | WBPaper00004407 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1446 | |||||||
Other_name | F56H9.5.1:c.2176C>T | ||||||||
CE05975:p.Gln726Ter | |||||||||
HGVSg | CHROMOSOME_V:g.12655433C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W05B10 | |||||
Flanking_sequences | tcaagaagaactgctagggcttatttggct | aaatgaaagaaggaattcctttttggaaaa | |||||||
Mapping_target | W05B10 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004407 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026902 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003011 | |||||||
Transcript | F56H9.5.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56H9.5.1:c.2176C>T | ||||||||
HGVSp | CE05975:p.Gln726Ter | ||||||||
cDNA_position | 2208 | ||||||||
CDS_position | 2176 | ||||||||
Protein_position | 726 | ||||||||
Exon_number | 9/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000002754 | ||||||||
WBInteraction000524063 | |||||||||
WBInteraction000524064 | |||||||||
WBInteraction000524065 | |||||||||
WBInteraction000524066 | |||||||||
WBInteraction000557741 | |||||||||
Genetics | Interpolated_map_position | V | 4.60147 | ||||||
Mapping_data | In_multi_point | 656 | |||||||
670 | |||||||||
671 | |||||||||
672 | |||||||||
673 | |||||||||
944 | |||||||||
1435 | |||||||||
Description | Phenotype (12) | ||||||||
Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-25(e1446) mutation did not induce the "2 P11.p" phenotype where the P12 cell adopts a P11 cell fate | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Vulval and P11.p phenotypes were scored in animals segregating from +/DnT1; lin-25/DnT1 or eor-1/DnT1; lin-25/DnT1 heterozygous mothers. | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males morphologically wildtype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00027035 | ||||||||
WBPaper00005344 | |||||||||
WBPaper00024311 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00014385 | |||||||||
WBPaper00057074 | |||||||||
Method | Substitution_allele |