WormBase Tree Display for Variation: WBVar00144007
expand all nodes | collapse all nodes | view schema
WBVar00144007 | Evidence | Paper_evidence | WBPaper00003566 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1439 | |||||||
Other_name | C09H6.2b.1:c.673C>A | ||||||||
C09H6.2a.1:c.673C>A | |||||||||
C09H6.2c.1:c.520C>A | |||||||||
CE27060:p.Gly225Arg | |||||||||
CE15610:p.Gly225Arg | |||||||||
CE42752:p.Gly174Arg | |||||||||
HGVSg | CHROMOSOME_I:g.8116726G>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09H6 | |||||
Flanking_sequences | aagtgaagaaaagcggaaattatccggtgat | gaacggattcactcattcgaaaacaaatgag | |||||||
Mapping_target | C09H6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003566 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004333 | ||||||||
WBStrain00026966 | |||||||||
WBStrain00030927 | |||||||||
WBStrain00033502 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002999 | |||||||
Transcript | C09H6.2c.1 (11) | ||||||||
C09H6.2b.1 (11) | |||||||||
C09H6.2a.1 (11) | |||||||||
Interactor | WBInteraction000502994 | ||||||||
WBInteraction000517466 | |||||||||
Genetics | Interpolated_map_position | I | 2.55923 | ||||||
Mapping_data | In_multi_point (25) | ||||||||
In_pos_neg_data | 740 | ||||||||
747 | |||||||||
749 | |||||||||
758 | |||||||||
Description | Phenotype | WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||
WBPaper00002375 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 24 percent of Vul hermaphrodites have 1 or more ventral protrusions. | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
On average less than one VPC adopts a vulval fate. | Paper_evidence | WBPaper00002375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Adult hermaphrodite vulvaless (penetrance 95%). Similar phenotype in e1439/Df. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
95% | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 95 | 95 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult male wildtype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00013806 | ||||||||
WBPaper00004883 | |||||||||
WBPaper00014218 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00002375 | |||||||||
WBPaper00015978 | |||||||||
Method | Substitution_allele |