WormBase Tree Display for Variation: WBVar00143995
expand all nodes | collapse all nodes | view schema
WBVar00143995 | Evidence | Person_evidence | WBPerson201 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1421 | |||||||
Other_name (13) | |||||||||
HGVSg | CHROMOSOME_II:g.14658033C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |||||
Flanking_sequences | cgctgctccaccacaagtcgaagctcgtta | tttttgcattgaacatttctatccttaagt | |||||||
Mapping_target | ZC101 | ||||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson201 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004332 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006787 | |||||||
Transcript (13) | |||||||||
Interactor (14) | |||||||||
Genetics | Interpolated_map_position | II | 23.3128 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson201 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are partially egg-laying defective. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are thin. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants exhibit initiation and termination problems in the dorsal and sub-ventral processes of the NSM, which often caused thickened endings | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Several previously described class I unc-52 alleles also showed significant increases in the frequency of DTC migration defects of weak unc-5 alleles. These include unc-52(e669), unc-52(e998), and unc-52(e1421) (Table 1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"An increase in the frequency of DTC migration defects was also observed in double mutants of unc-52(e1421) and the hypomorphic unc-5(ev644) allele (P < 0.001), indicating that the enhancement of unc-5(e152) was not allele-specific. unc-5(ev644) caused defects in 1% of anterior and 16% (n = 145) of posterior DTCs. The double mutant unc-5(ev644); unc-52(1421) [sic] exhibited defects in 10% of anterior and 27% of posterior DTCs (n = 165)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The low penetrance DTC defects of unc-5(ev585), unc-5(ev585)/+ (Table 1)... were also significantly enhanced by unc-52 class I mutants (Table 1)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"All class I unc-52 alleles (except e444) strongly enhanced the penetrance of DTC migration defects of a null allele of unc-5 (Table 1)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"To determine whether class I unc-52 mutations disrupted UNC-5 function, they were passed into a strain containing evIs99, an integrated emb-9::unc-5 transgenic array. In contrast to an unc-6 mutation (Su et al., 2000), unc-52(e1421) did not completely block precocious ventral-to-dorsal migrations (Fig. 3C). In evIs99 alone, precocious ventral-to-dorsal migrations occurred in 21% of anterior and 39% of posterior DTCs (n = 206). In the evls99; unc-52(e1421) background, these precocious migrations occurred in 11% (19/166; P < 0.005) of anterior and 38% (50/166; P > 0.4) of posterior DTCs. The frequency of these precocious migrations was significantly reduced relative to evIs99 alone only for the anterior DTCs." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(ev644) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(ev585) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
evIs99 [emb-9::unc-5] | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are limp. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000553 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000818 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000868 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are paralysed (except for head region). | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00046827 | |||||||
Curator_confirmed | WBPerson23340 | ||||||||
Remark | reduced and disorganized PVD 4th dendrites (Figure 2) | Paper_evidence | WBPaper00046827 | ||||||
Curator_confirmed | WBPerson23340 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00046827 | ||||
Curator_confirmed | WBPerson23340 | ||||||||
GO_term | GO:0016358 | PATO:0000460 | Paper_evidence | WBPaper00046827 | |||||
Curator_confirmed | WBPerson23340 | ||||||||
GO:0030425 | PATO:0000937 | Paper_evidence | WBPaper00046827 | ||||||
Curator_confirmed | WBPerson23340 | ||||||||
PATO:0001997 | Paper_evidence | WBPaper00046827 | |||||||
Curator_confirmed | WBPerson23340 | ||||||||
Phenotype_not_observed | WBPhenotype:0000060 | Paper_evidence | WBPaper00002086 | ||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Larvae move well until early adulthood. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00031671 | ||||||||
WBPaper00025979 | |||||||||
WBPaper00005809 | |||||||||
WBPaper00014555 | |||||||||
WBPaper00002086 | |||||||||
WBPaper00046827 | |||||||||
Method | Substitution_allele |