WormBase Tree Display for Variation: WBVar00143986
expand all nodes | collapse all nodes | view schema
WBVar00143986 | Evidence | Paper_evidence | WBPaper00016044 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F54B11 | |||
Flanking_sequences | gatccatccttgccggaccactgggaagtg | caaaccttggtggtactacttcaggatcac | |||||
Mapping_target | F54B11 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003628 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006816 | |||||
Transcript | F54B11.3a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
HGVSc | F54B11.3a.1:c.271C>T | ||||||
HGVSp | CE28236:p.Pro91Ser | ||||||
cDNA_position | 276 | ||||||
CDS_position | 271 | ||||||
Protein_position | 91 | ||||||
Exon_number | 3/12 | ||||||
Codon_change | Cca/Tca | ||||||
Amino_acid_change | P/S | ||||||
F54B11.3b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
HGVSc | F54B11.3b.1:c.271C>T | ||||||
HGVSp | CE27761:p.Pro91Ser | ||||||
cDNA_position | 276 | ||||||
CDS_position | 271 | ||||||
Protein_position | 91 | ||||||
Exon_number | 3/9 | ||||||
Codon_change | Cca/Tca | ||||||
Amino_acid_change | P/S | ||||||
Interactor | WBInteraction000557936 | ||||||
WBInteraction000557938 | |||||||
Genetics | Interpolated_map_position | X | 13.7256 | ||||
Description | Phenotype | WBPhenotype:0000511 | Paper_evidence | WBPaper00045548 | |||
Curator_confirmed | WBPerson24422 | ||||||
Remark | Intermediate nuclear migration defect where 48.7% of nuclei fail to migrate. | Paper_evidence | WBPaper00045548 | ||||
Curator_confirmed | WBPerson24422 | ||||||
Reference | WBPaper00003628 | ||||||
WBPaper00016044 | |||||||
WBPaper00045548 | |||||||
Method | Substitution_allele |