WormBase Tree Display for Variation: WBVar00143954
expand all nodes | collapse all nodes | view schema
WBVar00143954 | Evidence | Paper_evidence | WBPaper00025237 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1377 | |||||||
Other_name | CE38955:p.Trp149Ter | ||||||||
F31F6.5.1:c.446G>A | |||||||||
HGVSg | CHROMOSOME_X:g.14889428G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F31F6 | |||||
Flanking_sequences | attttcaggatctatgcctgagctacgatt | ggtttgcggagccaacgagcatatccaaat | |||||||
Mapping_target | F31F6 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004313 | ||||||||
WBStrain00004378 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000902 | |||||||
Transcript | F31F6.5.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F31F6.5.1:c.446G>A | ||||||||
HGVSp | CE38955:p.Trp149Ter | ||||||||
cDNA_position | 453 | ||||||||
CDS_position | 446 | ||||||||
Protein_position | 149 | ||||||||
Exon_number | 4/16 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000052365 | ||||||||
WBInteraction000501858 | |||||||||
Genetics | Interpolated_map_position | X | 21.4994 | ||||||
Mapping_data | In_2_point | 283 | |||||||
419 | |||||||||
420 | |||||||||
421 | |||||||||
In_multi_point | 649 | ||||||||
In_pos_neg_data | 2161 | ||||||||
2169 | |||||||||
2228 | |||||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 4; 30-100% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ADE or PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |