WormBase Tree Display for Variation: WBVar00143950
expand all nodes | collapse all nodes | view schema
WBVar00143950 | Evidence | Paper_evidence | WBPaper00031486 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1371 | ||||||
Other_name | CE50158:p.Gly727Glu | |||||||
Y55D5A.5e.1:c.2180G>A | ||||||||
Y55D5A.5d.1:c.2267G>A | ||||||||
CE46852:p.Gly803Glu | ||||||||
Y55D5A.5c.1:c.2408G>A | ||||||||
CE50312:p.Gly756Glu | ||||||||
Y55D5A.5a.1:c.2408G>A | ||||||||
CE50204:p.Gly803Glu | ||||||||
HGVSg | CHROMOSOME_III:g.3010491C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | ||||
Flanking_sequences | ttacgtgggaagcgccgctccaaccgaacg | agacctcacgcattacacaattatgtggcg | ||||||
Mapping_target | Y55D5A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006380 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000898 | ||||||
Transcript | Y55D5A.5e.1 (12) | |||||||
Y55D5A.5a.1 (12) | ||||||||
Y55D5A.5c.1 (12) | ||||||||
Y55D5A.5d.1 (12) | ||||||||
Genetics | Interpolated_map_position | III | -8.07283 | |||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00032150 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The mean lifespans at 20C +/- SE were: N2: 16.70.49; daf-2(e1371): 26.51.2. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Worms had mildly increased levels of fat storage (TAGs) compared to N2. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001742 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Worms had mildly increased levels of synthesized fatty acids compared to N2. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002267 | Paper_evidence | WBPaper00056618 | ||||||
Curator_confirmed | WBPerson2977 | |||||||
Phenotype_not_observed | WBPhenotype:0000681 | Paper_evidence | WBPaper00037649 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are as sensitive as WT. | Paper_evidence | WBPaper00037649 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00037649 | |||||||
WBPaper00032150 | ||||||||
WBPaper00056618 | ||||||||
Method | Substitution_allele |