WormBase Tree Display for Variation: WBVar00143947
expand all nodes | collapse all nodes | view schema
WBVar00143947 | Evidence | Paper_evidence | WBPaper00002847 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1368 | |||||||
Other_name (9) | |||||||||
HGVSg | CHROMOSOME_III:g.3012843G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | |||||
Flanking_sequences | tccggaatttacgacgtattgaggcaaagt | actgttcagaaatctatatgctatcacagt | |||||||
Mapping_target | Y55D5A | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004883 | ||||||||
WBStrain00004930 | |||||||||
WBStrain00004931 | |||||||||
WBStrain00004933 | |||||||||
WBStrain00005458 | |||||||||
WBStrain00006381 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000898 | |||||||
Transcript | Y55D5A.5e.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y55D5A.5e.1:c.1490C>T | ||||||||
HGVSp | CE50158:p.Ser497Leu | ||||||||
cDNA_position | 1490 | ||||||||
CDS_position | 1490 | ||||||||
Protein_position | 497 | ||||||||
Exon_number | 7/15 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
Y55D5A.5a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y55D5A.5a.1:c.1718C>T | ||||||||
HGVSp | CE46852:p.Ser573Leu | ||||||||
cDNA_position | 1816 | ||||||||
CDS_position | 1718 | ||||||||
Protein_position | 573 | ||||||||
Exon_number | 10/19 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
Y55D5A.5c.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y55D5A.5c.1:c.1718C>T | ||||||||
HGVSp | CE50204:p.Ser573Leu | ||||||||
cDNA_position | 1881 | ||||||||
CDS_position | 1718 | ||||||||
Protein_position | 573 | ||||||||
Exon_number | 11/21 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
Y55D5A.5d.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y55D5A.5d.1:c.1577C>T | ||||||||
HGVSp | CE50312:p.Ser526Leu | ||||||||
cDNA_position | 1577 | ||||||||
CDS_position | 1577 | ||||||||
Protein_position | 526 | ||||||||
Exon_number | 8/16 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
Interactor (52) | |||||||||
Genetics | Interpolated_map_position | III | -8.06017 | ||||||
Mapping_data | In_2_point | 411 | |||||||
412 | |||||||||
In_multi_point | 347 | ||||||||
1396 | |||||||||
1657 | |||||||||
1850 | |||||||||
1851 | |||||||||
1853 | |||||||||
2038 | |||||||||
2439 | |||||||||
Description | Phenotype (21) | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | ||||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00039871 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | vit-2/5 mRNA levels were similar to wildtype on days 1,2,and 4. | Paper_evidence | WBPaper00039871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals did not display an abnormal aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are sensitive to DMPP. | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms exhibited similar levels of fat storage (TAGs) to N2. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001742 | Paper_evidence | WBPaper00032150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms had similar to N2 levels of synthesized fatty acids. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001987 | Paper_evidence | WBPaper00001039 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals contained normal levels of AChE activity. | Paper_evidence | WBPaper00001039 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (37) | |||||||||
Method | Substitution_allele |