WormBase Tree Display for Variation: WBVar00143937
expand all nodes | collapse all nodes | view schema
WBVar00143937 | Evidence | Paper_evidence | WBPaper00001835 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1350 | |||||||
Other_name | B0491.2.1:c.205C>T | ||||||||
B0491.2.2:c.205C>T | |||||||||
CE02104:p.Arg69Cys | |||||||||
HGVSg | CHROMOSOME_II:g.11337498G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0491 | |||||
Flanking_sequences | tgtcatcggaagatctagcaagcgtgtccgt | gtcaatatgaagagaccaacgctaccccaa | |||||||
Mapping_target | B0491 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001835 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004306 | ||||||||
WBStrain00005655 | |||||||||
WBStrain00006230 | |||||||||
WBStrain00006236 | |||||||||
WBStrain00006241 | |||||||||
WBStrain00022554 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00005016 | |||||||
Transcript | B0491.2.2 (12) | ||||||||
B0491.2.1 (12) | |||||||||
Interactor | WBInteraction000052496 | ||||||||
WBInteraction000052555 | |||||||||
WBInteraction000052565 | |||||||||
WBInteraction000052580 | |||||||||
WBInteraction000537320 | |||||||||
Genetics | Interpolated_map_position | II | 3.44049 | ||||||
Mapping_data | In_2_point (7) | ||||||||
In_multi_point | 296 | ||||||||
338 | |||||||||
1054 | |||||||||
1243 | |||||||||
1385 | |||||||||
2792 | |||||||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000502 | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000906 | |||||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Less dumpy at 25C than at 16C. | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00000906 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00005747 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Alae are beaded and loops are present. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "severe disruption with branching" (Table 1); "Furthermore, by comparison to the well-defined longitudinal ala ridges in the wild-type nematodes (Fig 1A,E), the alae of sqt-1(e1350) mutants appear to be composed of short, wispy fragments (Fig. 4C)." | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Struts are absent. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00005747 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Annulae are severely effected; only smooth or rough surfaces are present. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "severe disruption" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00001280 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not show any level of immunofluorescence significantly higher than wild-type controls. | Paper_evidence | WBPaper00001280 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (11) | |||||||||
Method | Substitution_allele |