WormBase Tree Display for Variation: WBVar00143933
expand all nodes | collapse all nodes | view schema
WBVar00143933 | Evidence | Paper_evidence | WBPaper00002018 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1343 | |||||||
Other_name | CE15257:p.Pro171Leu | ||||||||
ZK154.3.1:c.512C>T | |||||||||
HGVSg | CHROMOSOME_X:g.7775879G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK154 | |||||
Flanking_sequences | accggataatgaacaccttctcggtagttc | aagtccaaaagtatccgacactgtagtcga | |||||||
Mapping_target | ZK154 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004341 | ||||||||
WBStrain00004384 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003171 | |||||||
Transcript | ZK154.3.1 (11) | ||||||||
Genetics | Interpolated_map_position | X | -1.27579 | ||||||
Mapping_data | In_2_point | 167 | |||||||
672 | |||||||||
In_multi_point | 280 | ||||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | ||||||||
Remark | Mutants heterozygous (but not homozygous) for mec-7 alleles e1505, e1343, e1522, and e1527 have a temperature-sensitive Mec phenotype, i.e., they are temperature sensitive dominants. Temperature-shift experiments with e1343/+ and e1522/+ heterozygotes suggest that mec-7 is needed throughout larval development for adult touch sensitivity. | Paper_evidence | WBPaper00000550 | ||||||
Curator_confirmed | WBPerson95 | ||||||||
Dominant | Paper_evidence | WBPaper00000550 | |||||||
Curator_confirmed | WBPerson95 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000550 | ||||||
Curator_confirmed | WBPerson95 | ||||||||
Phenotype_assay | Genotype | e1343/+ | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Touch insensitive, e1343/+ variably touch insensitive at 25C; wildtype at 15C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00000502 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lethargic at 25C | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Touch cells lack large specialized microtubules. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001588 | Paper_evidence | WBPaper00000550 | |||||||
Curator_confirmed | WBPerson95 | ||||||||
Remark | mec-7(e1343) mutants lack 15-protofilament microtubules in the touch receptor neurons (they have the 11-protofilament microtubules found in other cells. | Paper_evidence | WBPaper00000550 | ||||||
Curator_confirmed | WBPerson95 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00000550 | ||||
Curator_confirmed | WBPerson95 | ||||||||
GO_term | GO:0005874 | PATO:0000460 | Paper_evidence | WBPaper00000550 | |||||
Curator_confirmed | WBPerson95 | ||||||||
WBPhenotype:0001676 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | microtubule cells lack 15-protofilament microtubules | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000502 | ||||||||
WBPaper00002018 | |||||||||
WBPaper00015957 | |||||||||
WBPaper00000550 | |||||||||
Method | Substitution_allele |