WormBase Tree Display for Variation: WBVar00143929
expand all nodes | collapse all nodes | view schema
WBVar00143929 | Evidence | Paper_evidence | WBPaper00024641 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1339 | ||||||
Other_name | T01C8.7.1:c.689G>A | |||||||
CE39109:p.Gly230Glu | ||||||||
HGVSg | CHROMOSOME_X:g.16806019C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F41G4 | ||||
Flanking_sequences | gtgatttatctggagcattttttgagccag | atttgcaagatgcctttgtggaagccaagg | ||||||
Mapping_target | F41G4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024641 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004303 | |||||||
WBStrain00006192 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003168 | ||||||
Transcript | T01C8.7.1 (12) | |||||||
Genetics | Interpolated_map_position | X | 24.0629 | |||||
Mapping_data | In_2_point | 172 | ||||||
In_multi_point | 277 | |||||||
Description | Phenotype | WBPhenotype:0000316 | Paper_evidence | WBPaper00000502 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants are often touch sensitive in the tail | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
weak allele compared to u52, sometimes touch sensitive in tail | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals fail to respond to light touch applied manually with an eyelash. | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000850 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00049074 | ||||||
Curator_confirmed | WBPerson6118 | |||||||
Remark | enhanced reversing rate off food and reduced reversing rate on food compared to N2 | Paper_evidence | WBPaper00049074 | |||||
Curator_confirmed | WBPerson6118 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049074 | ||||
Curator_confirmed | WBPerson6118 | |||||||
WBPhenotype:0001773 | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not show an increased speed when placed in liquid-filled, microfluidic chambers containing a square array of posts. Animals moved much more slowly compared to wild type in these chambers and failed to sustain the enhanced swimming pattern exhibited by wild-type animals. | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002134 | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The fraction of mec-4(e1339) mutant animals that managed to escape from fungal traps of Drechslerella spp.: D. dactyloides, was drastically reduced compared to the wild-type fraction of escapers. | Paper_evidence | WBPaper00039982 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no differences in movement on agar compared to wild-type animals. | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no differences in movement in bulk fluids compared to wild-type animals. | Paper_evidence | WBPaper00031965 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00039982 | |||||||
WBPaper00000502 | ||||||||
WBPaper00031965 | ||||||||
WBPaper00049074 | ||||||||
WBPaper00064927 | ||||||||
Method | Substitution_allele |