WormBase Tree Display for Variation: WBVar00143918

WBVar00143918 Name: Public_name: e1323
    Other_name (18)
    HGVSg: CHROMOSOME_IV:g.7432528C>T
  Sequence_details: SMap: S_parent: Sequence: B0496
    Flanking_sequences: CCGGAAGCAGAAGCTCGTCGTATATTCCGA AAATCACTTCTGCAGTCCTTTATTGCCATA
    Mapping_target: B0496
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00035423
            Person_evidence: WBPerson267
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (137)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006814
    Transcript: B0496.3h.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3h.2:c.490C>T
        HGVSp: CE44339:p.Gln164Ter
        cDNA_position: 490
        CDS_position: 490
        Protein_position: 164
        Exon_number: 4/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3a.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3a.2:c.490C>T
        HGVSp: CE44329:p.Gln164Ter
        cDNA_position: 504
        CDS_position: 490
        Protein_position: 164
        Exon_number: 5/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3b.1:c.490C>T
        HGVSp: CE44280:p.Gln164Ter
        cDNA_position: 490
        CDS_position: 490
        Protein_position: 164
        Exon_number: 4/31
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3i.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3i.1:c.541C>T
        HGVSp: CE49580:p.Gln181Ter
        cDNA_position: 541
        CDS_position: 541
        Protein_position: 181
        Exon_number: 4/30
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3g.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3g.1:c.490C>T
        HGVSp: CE44297:p.Gln164Ter
        cDNA_position: 595
        CDS_position: 490
        Protein_position: 164
        Exon_number: 7/32
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3a.1:c.490C>T
        HGVSp: CE44329:p.Gln164Ter
        cDNA_position: 959
        CDS_position: 490
        Protein_position: 164
        Exon_number: 10/33
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3e.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3e.1:c.1207C>T
        HGVSp: CE44360:p.Gln403Ter
        cDNA_position: 1209
        CDS_position: 1207
        Protein_position: 403
        Exon_number: 10/35
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3f.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3f.1:c.490C>T
        HGVSp: CE44278:p.Gln164Ter
        cDNA_position: 490
        CDS_position: 490
        Protein_position: 164
        Exon_number: 4/29
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3h.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3h.1:c.490C>T
        HGVSp: CE44339:p.Gln164Ter
        cDNA_position: 595
        CDS_position: 490
        Protein_position: 164
        Exon_number: 7/31
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      B0496.3d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0496.3d.1:c.490C>T
        HGVSp: CE44346:p.Gln164Ter
        cDNA_position: 595
        CDS_position: 490
        Protein_position: 164
        Exon_number: 7/33
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000500073
      WBInteraction000500075
  Genetics: Interpolated_map_position: IV 3.3349
    Mapping_data: In_multi_point: 912
        913
        914
        915
      In_pos_neg_data: 3262
  Description: Phenotype: WBPhenotype:0000781 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit defects in actin distribution. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
      WBPhenotype:0000782 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit defects in the localization of thick filament components. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
      WBPhenotype:0000904 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Animals lack organized striations and contain brightly birefringent material at the ends of the cells. Multiple M-line, thick-filament, thin-filament proteins have been found to be disorganized compared to wild type patterns of protein distribution. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
      WBPhenotype:0001403 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit profound defects in the distribution of the thick filament proteins myosin and paramyosin. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
      WBPhenotype:0001891 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit defects in the localization of M-line components. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000815 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: Despite eventual loss of coordination, animals exhibited normal twitching and body contractions as developing embryos. Further, the distribution of sarcomere proteins through the 1.5 fold stage embryo was indistinguishable from wild type embryos. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
      WBPhenotype:0001890 Paper_evidence: WBPaper00035423
        Curator_confirmed: WBPerson712
        Remark: The distribution of dense body components alpha-actinin and viniculin were not affected. Paper_evidence: WBPaper00035423
            Curator_confirmed: WBPerson712
  Reference: WBPaper00015926
    WBPaper00013649
    WBPaper00012563
    WBPaper00018834
    WBPaper00026505
    WBPaper00035423
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006814 Ochre_UAA Q(403) to stop Paper_evidence: WBPaper00035423
  Method: Substitution_allele