WormBase Tree Display for Variation: WBVar00143912
expand all nodes | collapse all nodes | view schema
WBVar00143912 | Evidence | Paper_evidence | WBPaper00004437 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1314 | |||||||
Other_name | F22B7.10.1:c.1553-1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8660660C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F22B7 | |||||
Flanking_sequences | ctgcattactaaatatttattcatccttca | gaattccaaatatccgtcaacagttgaatg | |||||||
Mapping_target | F22B7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004437 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004297 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001078 | |||||||
Transcript | F22B7.10.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F22B7.10.1:c.1553-1G>A | ||||||||
Intron_number | 10/14 | ||||||||
Genetics | Interpolated_map_position | III | -0.191927 | ||||||
Description | Phenotype | WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As predicted, we found that in unc-40 and dpy-19 mutants, the QL descendants sometimes migrated anteriorly and the QR descendants sometimes remained in the posterior (Fig. 7 and Hedgecock et al., 1990)." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00004437 | ||||||||
Method | Substitution_allele |