WormBase Tree Display for Variation: WBVar00143907

WBVar00143907 Evidence: Person_evidence: WBPerson10095
  Name: Public_name: e1308
    Other_name: F59E12.12.1:c.545G>T
      CE11540:p.Gly182Val
      F59E12.2.1:c.1310+528C>A
    HGVSg: CHROMOSOME_II:g.5651830C>A
  Sequence_details: SMap: S_parent: Sequence: F59E12
    Flanking_sequences: agaccatctttcccgtttcttcctggttgt cctttgatccaatatttcctggtggtcctg
    Mapping_target: F59E12
    Type_of_mutation: Substitution: c a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00051521
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00000252
      WBGene00006988
    Transcript: F59E12.12.1 (12)
      F59E12.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F59E12.2.1:c.1310+528C>A
        Intron_number: 5/8
  Genetics: Gene_class: bli
    Interpolated_map_position: II -0.988411
  Remark: alt_det = g to t mut_det = G182V Person_evidence: WBPerson10095
      Curator_confirmed: WBPerson51134
    Variation information submitted by WBPerson10095 on 2022-02-17_15:31:00 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). Curator_confirmed: WBPerson51134
    temperature sensitive: Bli at 25C Person_evidence: WBPerson10095
      Curator_confirmed: WBPerson51134
  Method: Substitution_allele