WormBase Tree Display for Variation: WBVar00143898
expand all nodes | collapse all nodes | view schema
| WBVar00143898 | Evidence | Person_evidence | WBPerson10095 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1295 | |||||
| Other_name | F54D8.1.1:c.329dup | ||||||
| CE11066:p.Thr111AsnfsTer57 | |||||||
| HGVSg | CHROMOSOME_III:g.5107661dup | ||||||
| Sequence_details | SMap | S_parent | Sequence | F54D8 | |||
| Flanking_sequences | cccaggaaatactggatcatcgaacacccc | aactcttccaggagttattggagttccacc | |||||
| Mapping_target | F54D8 | ||||||
| Type_of_mutation | Insertion | C | |||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004292 | ||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001076 | |||||
| Transcript | F54D8.1.1 | VEP_consequence | frameshift_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F54D8.1.1:c.329dup | ||||||
| HGVSp | CE11066:p.Thr111AsnfsTer57 | ||||||
| cDNA_position | 332-333 | ||||||
| CDS_position | 329-330 | ||||||
| Protein_position | 110 | ||||||
| Exon_number | 2/4 | ||||||
| Codon_change | cca/ccCa | ||||||
| Amino_acid_change | P/PX | ||||||
| Genetics | Interpolated_map_position | III | -2.1354 | ||||
| Description | Phenotype | WBPhenotype:0000124 | Paper_evidence | WBPaper00042218 | |||
| Curator_confirmed | WBPerson21339 | ||||||
| Remark | mutant lacks C-mannosyltransferase activity, based on enzymatic assays with worm extract. | Paper_evidence | WBPaper00042218 | ||||
| Curator_confirmed | WBPerson21339 | ||||||
| WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00032446 | ||||||
| WBPaper00033444 | |||||||
| WBPaper00015216 | |||||||
| WBPaper00042218 | |||||||
| Remark | Variation information submitted by WBPerson10095 on 2022-02-17_11:25:16 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||
| alt_det = insert one C, Frameshift | Person_evidence | WBPerson10095 | |||||
| Curator_confirmed | WBPerson51134 | ||||||
| Method | Insertion_allele |
