WormBase Tree Display for Variation: WBVar00143888
expand all nodes | collapse all nodes | view schema
WBVar00143888 | Evidence | Person_evidence | WBPerson3709 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1282 | |||||||
Other_name | e1282ts | ||||||||
CE40520:p.Pro354Leu | |||||||||
T22B3.1.1:c.1061C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.11697099G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T22B3 | |||||
Flanking_sequences | ttctttccaatttcagaaaaactgagcatc | agtatgggcattcttcaaacgtaccggaga | |||||||
Mapping_target | T22B3 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson3709 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (133) | |||||||||
Laboratory | CB | ||||||||
MT | |||||||||
PD | |||||||||
NL | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001079 | |||||||
Transcript | T22B3.1.1 (12) | ||||||||
Interactor | WBInteraction000519994 | ||||||||
WBInteraction000519995 | |||||||||
WBInteraction000519996 | |||||||||
WBInteraction000519997 | |||||||||
Genetics | Interpolated_map_position | IV | 5.21445 | ||||||
Mapping_data | In_2_point (16) | ||||||||
In_multi_point (89) | |||||||||
In_pos_neg_data | 962 | ||||||||
967 | |||||||||
971 | |||||||||
1656 | |||||||||
1657 | |||||||||
1658 | |||||||||
1659 | |||||||||
1660 | |||||||||
3820 | |||||||||
3824 | |||||||||
3846 | |||||||||
3860 | |||||||||
3877 | |||||||||
3885 | |||||||||
3895 | |||||||||
4691 | |||||||||
6736 | |||||||||
6740 | |||||||||
6750 | |||||||||
6755 | |||||||||
6761 | |||||||||
8036 | |||||||||
8037 | |||||||||
8057 | |||||||||
8279 | |||||||||
Description | Phenotype (18) | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 88%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00029013 | |||||||||
WBPaper00001328 | |||||||||
WBPaper00001011 | |||||||||
WBPaper00015528 | |||||||||
WBPaper00012677 | |||||||||
WBPaper00000813 | |||||||||
WBPaper00014349 | |||||||||
WBPaper00011078 | |||||||||
WBPaper00013987 | |||||||||
WBPaper00015247 | |||||||||
WBPaper00014840 | |||||||||
WBPaper00016536 | |||||||||
WBPaper00017996 | |||||||||
WBPaper00013923 | |||||||||
WBPaper00065340 | |||||||||
WBPaper00065712 | |||||||||
WBPaper00065747 | |||||||||
Method | Substitution_allele |