WormBase Tree Display for Variation: WBVar00143888
expand all nodes | collapse all nodes | view schema
| WBVar00143888 | Evidence | Person_evidence | WBPerson3709 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1282 | |||||||
| Other_name | e1282ts | ||||||||
| CE40520:p.Pro354Leu | |||||||||
| T22B3.1.1:c.1061C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.11697099G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T22B3 | |||||
| Flanking_sequences | ttctttccaatttcagaaaaactgagcatc | agtatgggcattcttcaaacgtaccggaga | |||||||
| Mapping_target | T22B3 | ||||||||
| Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson3709 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (133) | |||||||||
| Laboratory | CB | ||||||||
| MT | |||||||||
| PD | |||||||||
| NL | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001079 | |||||||
| Transcript | T22B3.1.1 (12) | ||||||||
| Interactor | WBInteraction000519994 | ||||||||
| WBInteraction000519995 | |||||||||
| WBInteraction000519996 | |||||||||
| WBInteraction000519997 | |||||||||
| Genetics | Interpolated_map_position | IV | 5.21445 | ||||||
| Mapping_data | In_2_point (16) | ||||||||
| In_multi_point (89) | |||||||||
| In_pos_neg_data (25) | |||||||||
| Description | Phenotype (18) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals have 88%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (18) | |||||||||
| Method | Substitution_allele |
