WormBase Tree Display for Variation: WBVar00143882
expand all nodes | collapse all nodes | view schema
WBVar00143882 | Name | Public_name | e1275 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE31440:p.Arg175Ter | ||||||||
CE27833:p.Arg135Ter | |||||||||
C37F5.1b.1:c.403C>T | |||||||||
C37F5.1a.1:c.523C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.2278359G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37F5 | |||||
Flanking_sequences | atgtgttatgtcaaagacgagaaggacatt | gacacgagattccgtcgtttatgacgtcat | |||||||
Mapping_target | C37F5 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002352 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004287 | ||||||||
WBStrain00023477 | |||||||||
WBStrain00027069 | |||||||||
WBStrain00027143 | |||||||||
WBStrain00027276 | |||||||||
WBStrain00027384 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002990 | |||||||
Transcript | C37F5.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1a.1:c.523C>T | ||||||||
HGVSp | CE31440:p.Arg175Ter | ||||||||
cDNA_position | 523 | ||||||||
CDS_position | 523 | ||||||||
Protein_position | 175 | ||||||||
Exon_number | 4/7 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C37F5.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37F5.1b.1:c.403C>T | ||||||||
HGVSp | CE27833:p.Arg135Ter | ||||||||
cDNA_position | 411 | ||||||||
CDS_position | 403 | ||||||||
Protein_position | 135 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (20) | |||||||||
Genetics | Interpolated_map_position | IV | -8.48144 | ||||||
Mapping_data | In_2_point | 98 | |||||||
1642 | |||||||||
1643 | |||||||||
1646 | |||||||||
In_multi_point (15) | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 53% of fertile animals (n=36) exhibited an egg laying defect. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00026707 | |||||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | On average 4.25 VCPs (n=31 animals) are induced to adopt a vulval cell fate, which is increased compared to wild type (3/6 VPCs iinduced, n=29). VPCs and fate adoption were scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
3.8 (n=6) | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
The lin-1(e1275) mutation resulted in more than the expected number of induced vulval precursor cells (4.1 on average instead of 3.0 in wild type) | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Vulval induction was scored in late L3 to early L4 stage larvae, under Normarski optics. All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Vulval and P11.p phenotypes were scored in animals segregating from lin-1(e1275) unc-24/lin-1(e1275)+ mothers. | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
unc-24(e138) | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 12% animals produced progeny (n=41). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
WBPaper00026863 | |||||||||
WBPaper00036232 | |||||||||
WBPaper00026707 | |||||||||
WBPaper00005344 | |||||||||
WBPaper00005255 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | 88% animals display one or more ectopic pseudovulvae (n=357). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
weaker than e1777, slightly ts phenotype | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
100% of lin-1(e1275) animals have multiple vulva | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1 | Paper_evidence | WBPaper00005255 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 85% (n=337) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
62% penetrant | Paper_evidence | WBPaper00005255 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Complete | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive (2) | |||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000762 | ||||||
WBPaper00026863 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Vulval and P11.p phenotypes were scored in animals segregating from lin-1(e1275) unc-24/lin-1(e1275)+ mothers. | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Animals raised at 17.5 degrees Celsius | Paper_evidence | WBPaper00005255 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
17.5 | Paper_evidence | WBPaper00005255 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
unc-24(e138) | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Lethality was scored in animals segregating from homozygous mothers. | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-24(e138) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-1(e1275) mutation did not result in any animals with the '0 P11.p' phenotype (P11 adopts a P12 fate) or the '2 P11.p' phenotype (P12 adopts a P11 fate) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Vulval and P11.p phenotypes were scored in animals segregating from lin-1(e1275) unc-24/lin-1(e1275)+ mothers. | Paper_evidence | WBPaper00005344 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-24(e138) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | |||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | 0% animals (n=31) are aberrant in induction of VPCs. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00026863 | ||||||
WBPaper00005344 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Vulval and P11.p phenotypes were scored in animals segregating from lin-1(e1275) unc-24/lin-1(e1275)+ mothers. | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-17(e113) | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
unc-24(e138) | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |