WormBase Tree Display for Variation: WBVar00143879
expand all nodes | collapse all nodes | view schema
WBVar00143879 | Evidence | Paper_evidence | WBPaper00031000 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1272 | |||||
Other_name | F25C8.3a.1:c.7512G>A | ||||||
CE43592:p.Trp2542Ter | |||||||
CE41563:p.Trp2504Ter | |||||||
CE47428:p.Trp2439Ter | |||||||
F25C8.3b.1:c.7449G>A | |||||||
CE47117:p.Trp2483Ter | |||||||
F25C8.3e.1:c.7317G>A | |||||||
F25C8.3d.1:c.7626G>A | |||||||
F25C8.3c.1:c.7422G>A | |||||||
CE47217:p.Trp2474Ter | |||||||
HGVSg | CHROMOSOME_V:g.20895778G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F25C8 | |||
Flanking_sequences | agcagcagttaaacatgaaatatcgcaatg | atcacaatggctgtcgaaatgaaagcttta | |||||
Mapping_target | F25C8 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031000 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004286 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006812 | |||||
Transcript | F25C8.3d.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3d.1:c.7626G>A | ||||||
HGVSp | CE43592:p.Trp2542Ter | ||||||
cDNA_position | 7626 | ||||||
CDS_position | 7626 | ||||||
Protein_position | 2542 | ||||||
Exon_number | 31/37 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
F25C8.3b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3b.1:c.7449G>A | ||||||
HGVSp | CE47117:p.Trp2483Ter | ||||||
cDNA_position | 7702 | ||||||
CDS_position | 7449 | ||||||
Protein_position | 2483 | ||||||
Exon_number | 29/36 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
F25C8.3e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3e.1:c.7317G>A | ||||||
HGVSp | CE47428:p.Trp2439Ter | ||||||
cDNA_position | 7317 | ||||||
CDS_position | 7317 | ||||||
Protein_position | 2439 | ||||||
Exon_number | 27/34 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
F25C8.3c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3c.1:c.7422G>A | ||||||
HGVSp | CE47217:p.Trp2474Ter | ||||||
cDNA_position | 7422 | ||||||
CDS_position | 7422 | ||||||
Protein_position | 2474 | ||||||
Exon_number | 29/35 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
F25C8.3a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | F25C8.3a.1:c.7512G>A | ||||||
HGVSp | CE41563:p.Trp2504Ter | ||||||
cDNA_position | 7512 | ||||||
CDS_position | 7512 | ||||||
Protein_position | 2504 | ||||||
Exon_number | 30/37 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Interactor | WBInteraction000052191 | ||||||
WBInteraction000052325 | |||||||
WBInteraction000052354 | |||||||
WBInteraction000503536 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031000 | |||
Genetics | Interpolated_map_position | V | 25.6082 | ||||
Description | Phenotype | WBPhenotype:0000044 | Paper_evidence | WBPaper00000958 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals lay unusually small eggs. | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | slightly sluggish | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001048 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | hypersensitive to volatile anaesthetics | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001592 | Paper_evidence | WBPaper00000958 | |||||
WBPaper00031592 | |||||||
Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Fainter phenotype reported to authors by J.A. Lewis. | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | ||||||
Animals exhibit recessive and fully penetrant fainter phenotypes identical to that of the nca(lf) double mutant. | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
tends to pause ("fainter") | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000958 | |||||
WBPaper00031592 | |||||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001610 | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay (2) | |||||||
WBPhenotype:0001611 | Paper_evidence | WBPaper00000958 | |||||
WBPaper00002037 | |||||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals have a lower EC50 (1.28 0.04 vol%) compared to N2 (3.2 0.06 vol%). By 2 vol% halothane, virtually all unc-80 animals were completely immobile. EC50 is the effective dose at which 50% of the animals are anesthetized. | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay (2) | |||||||
Phenotype_not_observed | WBPhenotype:0001608 | Paper_evidence | WBPaper00002037 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay (2) | |||||||
WBPhenotype:0001609 | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_assay (2) | |||||||
WBPhenotype:0004018 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | good movement | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00014310 | ||||||
WBPaper00000958 | |||||||
WBPaper00002037 | |||||||
WBPaper00031592 | |||||||
WBPaper00003257 | |||||||
Method | Substitution_allele |