WormBase Tree Display for Variation: WBVar00143855
expand all nodes | collapse all nodes | view schema
WBVar00143855 | Evidence | Paper_evidence | WBPaper00026868 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1241 | |||||||
Other_name | CE24772:p.Ile112Lys | ||||||||
B0414.2.2:c.335T>A | |||||||||
B0414.2.3:c.335T>A | |||||||||
B0414.2.1:c.335T>A | |||||||||
HGVSg | CHROMOSOME_I:g.5786129T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0414 | |||||
Flanking_sequences | caggccgaaaattccatttgacaatcgtta | acattcggcgccgatgatggtggccaccgt | |||||||
Mapping_target | B0414 | ||||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00026868 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004456 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004393 | |||||||
Transcript | B0414.2.3 (12) | ||||||||
B0414.2.2 (12) | |||||||||
B0414.2.1 (12) | |||||||||
Interactor | WBInteraction000524834 | ||||||||
Genetics | Interpolated_map_position | I | 0.447435 | ||||||
Mapping_data | In_2_point | 329 | |||||||
In_multi_point | 205 | ||||||||
Description | Phenotype | WBPhenotype:0000342 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Bursa often grossly distorted. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000827 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hermaphrodite gross phenotype normal; late hypodermal V divisions variably defective; very hard to score (ES1) in hermaphrodite. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000828 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Late hypodermal T divisions variably defective; very hard to score (ES1) in hermaphrodite. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000938 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult male has 6-18 missing copulatory rays as a result of variable failures of V lineages; easy to score (ES3) in adult male. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000939 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult male has 6-18 missing copulatory rays as a result of variable failures of T lineages; easy to score (ES3) in adult male. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001225 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We first examined the Psa phenotype in the T cells of hermaphrodites of all the rnt-1 alleles. A large proportion (51%-77%) of the mutants exhibited the Psa phenotype (Table 2)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 55 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Psa phenotype (see Materials and methods) was scored during the L2 stage." | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating not or rarely successful (ME0/ME1). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001509 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult male has 6-18 missing copulatory rays. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We next performed phasmid dye-filling analysis on hermaphrodites from all the alleles. Again, a large proportion (46%-73%) of the mutants displayed the Dyf phenotype (Table 2)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 60 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001025 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hermaphrodite gross phenotype normal. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00026860 | ||||||||
WBPaper00011437 | |||||||||
Method | Substitution_allele |