WormBase Tree Display for Variation: WBVar00143847
expand all nodes | collapse all nodes | view schema
WBVar00143847 | Name | Public_name | e1228 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE30258:p.Trp1120Ter | |||||||
C48B6.6b.1:c.3366G>A | ||||||||
C48B6.6a.1:c.3360G>A | ||||||||
CE53740:p.Trp1122Ter | ||||||||
HGVSg | CHROMOSOME_I:g.6907231C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C48B6 | ||||
Flanking_sequences | AAATCTTGTCAATAAAATGACTGGTGTCTCACAATG | AAGAATAAACTCACTGATACGGAAATATTCGATAGAAATGAAGA | ||||||
Mapping_target | C48B6 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004449 | |||||||
WBStrain00004569 | ||||||||
WBStrain00007440 | ||||||||
WBStrain00007451 | ||||||||
WBStrain00008044 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004879 | ||||||
Transcript | C48B6.6b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C48B6.6b.1:c.3366G>A | |||||||
HGVSp | CE53740:p.Trp1122Ter | |||||||
cDNA_position | 3366 | |||||||
CDS_position | 3366 | |||||||
Protein_position | 1122 | |||||||
Exon_number | 22/42 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
C48B6.6a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C48B6.6a.1:c.3360G>A | |||||||
HGVSp | CE30258:p.Trp1120Ter | |||||||
cDNA_position | 3388 | |||||||
CDS_position | 3360 | |||||||
Protein_position | 1120 | |||||||
Exon_number | 23/44 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000519151 | |||||||
WBInteraction000519160 | ||||||||
Genetics | Interpolated_map_position | I | 1.48154 | |||||
Mapping_data | In_2_point | 328 | ||||||
In_multi_point | 204 | |||||||
2089 | ||||||||
Description | Phenotype | WBPhenotype:0000506 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Adult male has swollen bursa; easy to score (ES3) in adult male. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000508 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | unc-54 nonsense RNAs accumulate | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Adult hermaphrodite has protruding vulva. Difficult to score (ES2). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Isolated from a male morphology screen. Suppresses paralysis in unc-54(r293), sterility in tra-2(e1209), Egl and alae defects in lin-29(n546) and Dpy phenotype in dpy-5(e61) | Paper_evidence | WBPaper00001192 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00001192 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0001828 | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | smg-1 homozygotes behaved like WT worms and did not recover from RNAi at all | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | RNAi injection | Paper_evidence | WBPaper00004325 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00014180 | |||||||
WBPaper00013926 | ||||||||
WBPaper00013705 | ||||||||
WBPaper00016504 | ||||||||
WBPaper00004325 | ||||||||
WBPaper00013780 | ||||||||
WBPaper00014346 | ||||||||
WBPaper00001192 | ||||||||
WBPaper00013893 | ||||||||
WBPaper00013706 | ||||||||
WBPaper00014275 | ||||||||
WBPaper00061172 | ||||||||
Remark | ||||||||
Method | Substitution_allele |