WormBase Tree Display for Variation: WBVar00143842

WBVar00143842 Name: Public_name: e1220
    Other_name (18)
    HGVSg: CHROMOSOME_IV:g.7432591G>A
  Sequence_details: SMap: S_parent: Sequence: B0496
    Flanking_sequences: CATCGGGTTGCTCACAGAGATTTAAAATTG AGAACATTCTTTTAGATCAAAATAATAATG
    Mapping_target: B0496
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00035423
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004275
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006814
    Transcript: B0496.3h.2 (12)
      B0496.3a.2 (12)
      B0496.3b.1 (12)
      B0496.3i.1 (12)
      B0496.3g.1 (12)
      B0496.3a.1 (12)
      B0496.3e.1 (12)
      B0496.3f.1 (12)
      B0496.3h.1 (12)
      B0496.3d.1 (12)
    Interactor: WBInteraction000500074
      WBInteraction000500076
  Genetics: Interpolated_map_position: IV 3.3349
  Description: Phenotype: WBPhenotype:0000509 Paper_evidence: WBPaper00000536
        Curator_confirmed: WBPerson712
        Remark: Only 2.3% of sperm have pseudopods, some of which are irregular. Paper_evidence: WBPaper00000536
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006798 PATO:0000460 Paper_evidence: WBPaper00000536
                Curator_confirmed: WBPerson712
      WBPhenotype:0000553 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: abnormal reduced muscle birefringence Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000646 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: slow, good movement Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000782 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: enlarged thick filaments Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000926 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: abnormal body muscle ultrastructure Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001046 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: pharyngeal muscle abnormalities weaker than body wall muscle ultrastructure abnormalitites Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Ease_of_scoring: ES2_Difficult_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0002469 Paper_evidence: WBPaper00038487
        Curator_confirmed: WBPerson712
        Remark: The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. Paper_evidence: WBPaper00038487
            Curator_confirmed: WBPerson712
      WBPhenotype:0004027 Paper_evidence: WBPaper00038487
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. Paper_evidence: WBPaper00038487
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038487
    WBPaper00000536
    WBPaper00015926
    WBPaper00013649
    WBPaper00013853
    WBPaper00012563
    WBPaper00018834
    WBPaper00035423
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006814 Missense 185 E185K
  Method: Substitution_allele