WormBase Tree Display for Variation: WBVar00143840
expand all nodes | collapse all nodes | view schema
WBVar00143840 | Evidence | Paper_evidence | WBPaper00004695 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1217 | |||||||
Other_name | C04F6.4a.1:c.1037G>A | ||||||||
CE03924:p.Gly346Glu | |||||||||
HGVSg | CHROMOSOME_X:g.3409755C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C04F6 | |||||
Flanking_sequences | gaaaaactcttttcagtgctgatgctgaag | acatattagtgagtagtttcagtgcttcga | |||||||
Mapping_target | C04F6 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004274 | ||||||||
WBStrain00006316 | |||||||||
WBStrain00026896 | |||||||||
WBStrain00033511 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006810 | |||||||
Transcript | C04F6.4a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | C04F6.4a.1:c.1037G>A | ||||||||
HGVSp | CE03924:p.Gly346Glu | ||||||||
cDNA_position | 1038 | ||||||||
CDS_position | 1037 | ||||||||
Protein_position | 346 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
Interactor | WBInteraction000518612 | ||||||||
WBInteraction000519181 | |||||||||
Genetics | Interpolated_map_position | X | -10.3445 | ||||||
Mapping_data | In_multi_point (11) | ||||||||
In_pos_neg_data (15) | |||||||||
Description | Phenotype | WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 1.4% of sperm have pseudopods, all of which have normal morphology; sperm were from hemizygous males. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000553 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal body muscle birefringence | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ES2 ME0 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000781 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal muscle ultrastructure with large aggregates of thin filaments | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000904 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal muscle ultrastructure | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00004883 | ||||||||
WBPaper00000536 | |||||||||
WBPaper00015999 | |||||||||
WBPaper00010561 | |||||||||
Method | Substitution_allele |