WormBase Tree Display for Variation: WBVar00143837
expand all nodes | collapse all nodes | view schema
| WBVar00143837 | Evidence | Paper_evidence | WBPaper00001431 | ||||
|---|---|---|---|---|---|---|---|
| Person_evidence | WBPerson267 | ||||||
| Name | Public_name | e1214 | |||||
| Other_name | F07A5.7a.1:c.490C>T | ||||||
| CE09197:p.Gln164Ter | |||||||
| F07A5.7a.2:c.490C>T | |||||||
| HGVSg | CHROMOSOME_I:g.7380225G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F07A5 | |||
| Flanking_sequences | gaagtcatcgagttgaccgccactatcgac | agctccagaaggacaaacacaccgctgaga | |||||
| Mapping_target | F07A5 | ||||||
| Type_of_mutation | Substitution | C | T | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004271 | ||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006754 | |||||
| Transcript | F07A5.7a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F07A5.7a.1:c.490C>T | ||||||
| HGVSp | CE09197:p.Gln164Ter | ||||||
| cDNA_position | 604 | ||||||
| CDS_position | 490 | ||||||
| Protein_position | 164 | ||||||
| Exon_number | 7/14 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| F07A5.7a.2 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F07A5.7a.2:c.490C>T | ||||||
| HGVSp | CE09197:p.Gln164Ter | ||||||
| cDNA_position | 604 | ||||||
| CDS_position | 490 | ||||||
| Protein_position | 164 | ||||||
| Exon_number | 7/13 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000503483 | ||||||
| Isolation | Mutagen | EMS | |||||
| Forward_genetics | standard phenotypic screen | ||||||
| Genetics | Interpolated_map_position | I | 2.05651 | ||||
| Mapping_data | In_multi_point | 311 | |||||
| Description | Phenotype | WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | limp paralysed phenotype; more severe phenotype than e73 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | limp paralysed phenotype, larvae move slightly better; more severe phenotype than e73 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference (13) | |||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Amber_UAG Q(164) to STOP | ||||||
| Method | Substitution_allele |
