WormBase Tree Display for Variation: WBVar00143821
expand all nodes | collapse all nodes | view schema
WBVar00143821 | Evidence | Paper_evidence | WBPaper00004275 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1196 | ||||||
Other_name (4) | ||||||||
HGVSg | CHROMOSOME_IV:g.13265305_13265306insC | |||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | ||||
Flanking_sequences | atttcaactatcgaattaatttgtcggggg | atgaagttaagaatgctgttagaaatggag | ||||||
Mapping_target | JC8 | |||||||
Type_of_mutation | Insertion | g | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004267 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006763 | ||||||
Transcript | JC8.10b.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | JC8.10b.1:c.2194dup | |||||||
HGVSp | CE29050:p.Asp732GlyfsTer2 | |||||||
cDNA_position | 2199-2200 | |||||||
CDS_position | 2194-2195 | |||||||
Protein_position | 732 | |||||||
Exon_number | 8/12 | |||||||
Codon_change | gat/gGat | |||||||
Amino_acid_change | D/GX | |||||||
JC8.10a.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | JC8.10a.1:c.2176dup | |||||||
HGVSp | CE28239:p.Asp726GlyfsTer2 | |||||||
cDNA_position | 2179-2180 | |||||||
CDS_position | 2176-2177 | |||||||
Protein_position | 726 | |||||||
Exon_number | 7/11 | |||||||
Codon_change | gat/gGat | |||||||
Amino_acid_change | D/GX | |||||||
Genetics | Interpolated_map_position | IV | 8.51247 | |||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00035198 | |||||||
WBPaper00014864 | ||||||||
WBPaper00004275 | ||||||||
WBPaper00015216 | ||||||||
WBPaper00013791 | ||||||||
Method | Insertion_allele |