WormBase Tree Display for Variation: WBVar00143806
expand all nodes | collapse all nodes | view schema
WBVar00143806 | Evidence | Paper_evidence | WBPaper00005177 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1180 | |||||||
Other_name | CE20819:p.Pro20ThrfsTer12 | ||||||||
F46E10.9.2:c.54dup | |||||||||
F46E10.9.1:c.54dup | |||||||||
HGVSg | CHROMOSOME_V:g.6513291dup | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46E10 | |||||
Flanking_sequences | ctcggacttttcgccgttggagtctcgggg | ggacctaccagatcttccaagctcgtcttt | |||||||
Mapping_target | F46E10 | ||||||||
Type_of_mutation | Insertion | g | |||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004263 | ||||||||
WBStrain00007270 | |||||||||
WBStrain00007454 | |||||||||
WBStrain00007455 | |||||||||
WBStrain00007456 | |||||||||
WBStrain00007457 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001073 | |||||||
Transcript | F46E10.9.2 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46E10.9.2:c.54dup | ||||||||
HGVSp | CE20819:p.Pro20ThrfsTer12 | ||||||||
cDNA_position | 208-209 | ||||||||
CDS_position | 54-55 | ||||||||
Protein_position | 18-19 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | -/G | ||||||||
Amino_acid_change | -/X | ||||||||
F46E10.9.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46E10.9.1:c.54dup | ||||||||
HGVSp | CE20819:p.Pro20ThrfsTer12 | ||||||||
cDNA_position | 55-56 | ||||||||
CDS_position | 54-55 | ||||||||
Protein_position | 18-19 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | -/G | ||||||||
Amino_acid_change | -/X | ||||||||
Interactor | WBInteraction000537327 | ||||||||
Genetics | Interpolated_map_position | V | -0.00140555 | ||||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00005177 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." | Paper_evidence | WBPaper00005177 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0048666 | PATO:0000460 | Paper_evidence | WBPaper00005177 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005747 | |||||||
WBPaper00005177 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | stronger dumpy than e224, or 'piggy' phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." | Paper_evidence | WBPaper00005177 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched ala" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "missing or amorphous annuli" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00005747 | ||||||||
WBPaper00005177 | |||||||||
WBPaper00015216 | |||||||||
Method | Insertion_allele |