WormBase Tree Display for Variation: WBVar00143800
expand all nodes | collapse all nodes | view schema
WBVar00143800 | Evidence | Paper_evidence | WBPaper00003628 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1174 | |||||
Other_name | F54B11.3b.1:c.118_496del | ||||||
F54B11.3a.1:c.118_496del | |||||||
CE28236:p.Leu40ProfsTer72 | |||||||
CE27761:p.Leu40ProfsTer72 | |||||||
HGVSg | CHROMOSOME_X:g.13584897_13585821del | ||||||
Sequence_details | SMap | S_parent | Sequence | F54B11 | |||
Flanking_sequences | ccaaacatttttgcaaaagttcgccggaag | cctaccaagatcatcgtcgccgtacagctc | |||||
Mapping_target | F54B11 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004261 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006816 | |||||
Transcript | F54B11.3a.1 (11) | ||||||
F54B11.3b.1 (11) | |||||||
Genetics | Interpolated_map_position | X | 13.7227 | ||||
Description | Phenotype | WBPhenotype:0000511 | Paper_evidence | WBPaper00045548 | |||
Curator_confirmed | WBPerson24422 | ||||||
Remark | Intermediate nuclear migration defect where 68.7% of nuclei fail to migrate. | Paper_evidence | WBPaper00045548 | ||||
Curator_confirmed | WBPerson24422 | ||||||
Reference | WBPaper00003628 | ||||||
WBPaper00015216 | |||||||
WBPaper00016044 | |||||||
WBPaper00017147 | |||||||
WBPaper00045548 | |||||||
Method | Deletion_allele |