WormBase Tree Display for Variation: WBVar00143796

WBVar00143796 Evidence: Person_evidence: WBPerson11112
  Name: Public_name: e1170
    Other_name: F55D12.4a.1:c.47dup
      F55D12.4b.1:c.47dup
      CE43454:p.Asp17ArgfsTer11
      CE43459:p.Asp17ArgfsTer11
    HGVSg: CHROMOSOME_I:g.7903287_7903288insG
  Sequence_details: SMap: S_parent: Sequence: F55D12
    Flanking_sequences: AGGTGCTGCAAGTCTTGGAAACAGTTCCCC AGATGCAACAGATTGTGTAGTATGTGGAGA
    Mapping_target: F55D12
    Type_of_mutation: Insertion: c
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004259
      WBStrain00006182
      WBStrain00040603
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006790
    Transcript: F55D12.4b.1 VEP_consequence: frameshift_variant
        VEP_impact: HIGH
        HGVSc: F55D12.4b.1:c.47dup
        HGVSp: CE43459:p.Asp17ArgfsTer11
        cDNA_position: 47-48
        CDS_position: 47-48
        Protein_position: 16
        Exon_number: 1/7
        Codon_change: cca/ccCa
        Amino_acid_change: P/PX
      F55D12.4a.1 VEP_consequence: frameshift_variant
        VEP_impact: HIGH
        HGVSc: F55D12.4a.1:c.47dup
        HGVSp: CE43454:p.Asp17ArgfsTer11
        cDNA_position: 47-48
        CDS_position: 47-48
        Protein_position: 16
        Exon_number: 1/8
        Codon_change: cca/ccCa
        Amino_acid_change: P/PX
    Interactor (28)
  Genetics: Interpolated_map_position: I 2.38989
    Mapping_data: In_multi_point: 3515
  Description: Phenotype: WBPhenotype:0000566 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Fig 3i, animals coil ventrally during reverse locomotion Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0000655 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1, endogenous IPSCs in the muscle are absent on the ventral side, and increased in frequency on the dorsal side, after ectopic VD synapse remodeling. Note that (Fig S3g-h) endogenous IPSC amplitudes are all normal. Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0000658 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1, endogenous IPSC frequency in the muscle is absent on the ventral side, and is increased in frequency on the dorsal side. Note that endogenous IPSC amplitudes are normal (Fig S3h) and endogenous EPSCs in the muscle are normal in both rate and amplitude (Fig S1 and S3). Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0000847 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1, in VD neurons the presynaptic component UNC-57::GFP is decreased in the ventral cord and increased in the dorsal cord after ectopic synapse remodeling. Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0001276 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 2 and S2, a transgene with the hbl-1 promotor (normally not expressed in VD neurons) is expressed in VD neurons. Fig 2c-f for VD10, Fig S2b-d for all VD neurons. Mutating the unc-55 binding sites in the hbl-1 promoter mimics this ectopic expression (Fig 2). Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0001319 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1, ventral IPSCs in the muscle are eliminated after ectopic VD synapse remodeling. Note that ventral EPSCs in the muscle are normal (Fig S1d-f). Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0001801 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1, VD neurons inappropriately remodel presynapses from the ventral cord into the dorsal cord (which normally only has postsynapses). Note that before ectopic remodeling, axodendritic polarity is normal (Fig S1g-j). Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0002232 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Figure 1 & S1, VD neurons ectopically remodel synapses from the ventral cord to the dorsal cord. Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0002262 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Fig S1b-c, in the muscle the postsynaptic component UNC-49 GABA(A) receptor is increased adjacent to the dorsal cord Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0004007 Paper_evidence: WBPaper00032054
        Curator_confirmed: WBPerson8772
        Remark: males will attempt but are unable to mate successfully. (Data submitted by Ge Shan and Bill Walthall) Paper_evidence: WBPaper00032054
            Curator_confirmed: WBPerson8772
    Phenotype_not_observed: WBPhenotype:0000625 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Fig S1 g-j, initial synaptogenesis (before ectopic VD neuron remodeling) properly locates presynaptic components (UNC-57 endophilin) in the ventral side of VD neurons adjacent to postsynaptic components (UNC-49 GABA-A receptor) in the ventral muscle, with normal synapse density Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0000656 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Fig S1d-f, endogenous EPSC rate and amplitude in the muscle are unchanged Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
      WBPhenotype:0001320 Paper_evidence: WBPaper00040787
        Curator_confirmed: WBPerson7245
        Remark: Fig S1d-f and S3d, endogenous EPSC amplitude is normal. Fig S3g-h, endogenous IPSC amplitude is normal. Paper_evidence: WBPaper00040787
            Curator_confirmed: WBPerson7245
  Reference: WBPaper00040787
    WBPaper00015216
    WBPaper00021904
    WBPaper00014720
    WBPaper00017613
    WBPaper00032054
  Method: Insertion_allele