WormBase Tree Display for Variation: WBVar00143789
expand all nodes | collapse all nodes | view schema
WBVar00143789 | Evidence | Paper_evidence | WBPaper00041308 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | C27H6 | |||
Flanking_sequences | ATAACATCACCAGATGCACCACACCAAGGG | GTAAGTAAGCTCATTTCTTTCGTTTCGGTT | |||||
Mapping_target | C27H6 | ||||||
Type_of_mutation | Insertion | g | Paper_evidence | WBPaper00041308 | |||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006777 | |||||
Transcript | C27H6.1b.1 | VEP_consequence | frameshift_variant,splice_region_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C27H6.1b.1:c.192dup | ||||||
HGVSp | CE45373:p.Ala65GlyfsTer11 | ||||||
cDNA_position | 192-193 | ||||||
CDS_position | 192-193 | ||||||
Protein_position | 64-65 | ||||||
Codon_change | -/G | ||||||
Amino_acid_change | -/X | ||||||
C27H6.1a.1 | VEP_consequence | frameshift_variant,splice_region_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C27H6.1a.1:c.1038dup | ||||||
HGVSp | CE45344:p.Ala347GlyfsTer11 | ||||||
cDNA_position | 1050-1051 | ||||||
CDS_position | 1038-1039 | ||||||
Protein_position | 346-347 | ||||||
Codon_change | -/G | ||||||
Amino_acid_change | -/X | ||||||
Genetics | Gene_class | unc | |||||
Interpolated_map_position | V | 2.2235 | |||||
Description | Phenotype | WBPhenotype:0000319 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | larger size, sd Unc phenotype. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Unc | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000507 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | normal acetylcholine levels, larger size, sd Unc phenotype. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00041308 | ||||||
WBPaper00002007 | |||||||
WBPaper00014640 | |||||||
WBPaper00061430 | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||
Method | Insertion_allele |