WormBase Tree Display for Variation: WBVar00143776

WBVar00143776 Evidence: Paper_evidence: WBPaper00006502
  Name: Public_name: e1147
    Other_name: CE07625:p.Pro16Ser
      ZK381.1a.1:c.46C>T
    HGVSg: CHROMOSOME_IV:g.6977571C>T
  Sequence_details: SMap: S_parent: Sequence: ZK381
    Flanking_sequences: cagattgttgagcaccgcgagtctgaaatt ctatagccagccagtggaaggccacgtttc
    Mapping_target: ZK381
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (84)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001862
    Transcript: ZK381.1a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: ZK381.1a.1:c.46C>T
        HGVSp: CE07625:p.Pro16Ser
        cDNA_position: 64
        CDS_position: 46
        Protein_position: 16
        Exon_number: 2/6
        Codon_change: Cct/Tct
        Amino_acid_change: P/S
  Genetics: Interpolated_map_position: IV 3.26837
    Mapping_data: In_multi_point: 109
        110
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: 1.4% eggs never hatch, yet are refractile; wild type animals produce 0.8% inviable zygotes. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0000863 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Males exhibit 74.1% wild type fertility. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0001175 Paper_evidence: WBPaper00000565
          WBPaper00000179
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Male self-progeny make up 2.6% population as measured from 4 broods, 1028 total animals. Paper_evidence: WBPaper00000565
            Curator_confirmed: WBPerson712
          Animals segregate 3.5% males compared to 0.3% segregated by wild type animals. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
          Self-progeny 3.5% XO male. Difficult to score (ES2) in progeny. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Ease_of_scoring: ES2_Difficult_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001583 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals segregate a small percentage (1.1%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0001631 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: 2% ova are nullo-X. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000143 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals have an average brood size of 35329 s.d. (6 broods counted), wild type has average brood size 33034 s.d. (8 broods counted). Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0000276 Paper_evidence: WBPaper00000565
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. Paper_evidence: WBPaper00000565
              Curator_confirmed: WBPerson712
      WBPhenotype:0000517 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals are indistinguishable from wild type in terms of behavior. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0000520 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
      WBPhenotype:0001631 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
  Reference: WBPaper00015329
    WBPaper00000565
    WBPaper00016279
    WBPaper00013698
    WBPaper00000179
    WBPaper00011748
    WBPaper00011726
  Method: Substitution_allele