WormBase Tree Display for Variation: WBVar00143766
expand all nodes | collapse all nodes | view schema
WBVar00143766 | Evidence | Paper_evidence | WBPaper00042411 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1128 | |||||||
Other_name | CE51364:p.Ala150Val | ||||||||
F26D11.10c.1:c.449C>T | |||||||||
CE51518:p.Ala153Val | |||||||||
CE51269:p.Ala150Val | |||||||||
CE51310:p.Ala153Val | |||||||||
F26D11.10b.1:c.458C>T | |||||||||
F26D11.10a.1:c.458C>T | |||||||||
F26D11.10d.1:c.449C>T | |||||||||
HGVSg | CHROMOSOME_V:g.7964520G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26D11 | |||||
Flanking_sequences | aatgggtgccgttttttctattactccaag | atttctctattacattccatgtctaatgtg | |||||||
Mapping_target | F26D11 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004251 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000488 | |||||||
Transcript | F26D11.10a.1 (12) | ||||||||
F26D11.10d.1 (12) | |||||||||
F26D11.10c.1 (12) | |||||||||
F26D11.10b.1 (12) | |||||||||
Genetics | Interpolated_map_position | V | 0.98683 | ||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00000214 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms are smaller than WT. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||||
WBPaper00042411 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Worms are 35% responsive to Na+ in behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 6B | Paper_evidence | WBPaper00042411 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004782 | Paper_evidence | WBPaper00042411 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0006935 | PATO:0000460 | Paper_evidence | WBPaper00042411 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
WBPaper00042411 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Worms swim away from attractant in a gradient selection assay and are 25% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
non-chemotactic to chloride ion | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Figure 6B | Paper_evidence | WBPaper00042411 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00001360 | Paper_evidence | WBPaper00042411 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0006935 | PATO:0000460 | Paper_evidence | WBPaper00042411 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001057 | Paper_evidence | WBPaper00042411 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 6B | Paper_evidence | WBPaper00042411 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003974 | Paper_evidence | WBPaper00042411 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0006935 | PATO:0000460 | Paper_evidence | WBPaper00042411 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00042411 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 6B | Paper_evidence | WBPaper00042411 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00042411 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0006935 | PATO:0000460 | Paper_evidence | WBPaper00042411 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000932 | ||||||||
WBPaper00006052 | |||||||||
WBPaper00001786 | |||||||||
WBPaper00000214 | |||||||||
WBPaper00042411 | |||||||||
WBPaper00064927 | |||||||||
Method | Substitution_allele |