WormBase Tree Display for Variation: WBVar00143763
expand all nodes | collapse all nodes | view schema
| WBVar00143763 | Evidence | Paper_evidence | WBPaper00004136 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1124 | |||||||
| Other_name | CE32386:p.Gln2233Ter | ||||||||
| F18C12.1.1:c.6697C>T | |||||||||
| HGVSg | CHROMOSOME_I:g.8071718G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F18C12 | |||||
| Flanking_sequences | ctgataacgggaacaactggatgtggaaaa | aacagcttctgaagcattgcttccagaatg | |||||||
| Mapping_target | F18C12 | ||||||||
| Type_of_mutation | Substitution | C | T | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004248 | ||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000485 | |||||||
| Transcript | F18C12.1.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F18C12.1.1:c.6697C>T | ||||||||
| HGVSp | CE32386:p.Gln2233Ter | ||||||||
| cDNA_position | 6697 | ||||||||
| CDS_position | 6697 | ||||||||
| Protein_position | 2233 | ||||||||
| Exon_number | 27/49 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000502224 | ||||||||
| WBInteraction000520981 | |||||||||
| WBInteraction000554845 | |||||||||
| Genetics | Interpolated_map_position | I | 2.44242 | ||||||
| Mapping_data | In_2_point | 787 | |||||||
| 2590 | |||||||||
| In_multi_point | 719 | ||||||||
| 1698 | |||||||||
| In_pos_neg_data | 8303 | ||||||||
| 8304 | |||||||||
| 8305 | |||||||||
| 8306 | |||||||||
| Description | Phenotype (31) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (21) | |||||||||
| Method | Substitution_allele |
