WormBase Tree Display for Variation: WBVar00143760
expand all nodes | collapse all nodes | view schema
WBVar00143760 | Evidence | Paper_evidence | WBPaper00002050 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1120 | |||||||
Other_name | Y60A3A.1.1:c.2522G>A | ||||||||
CE24516:p.Arg841His | |||||||||
HGVSg | CHROMOSOME_V:g.19996296C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | |||||
Flanking_sequences | tttacaggtacaaagtcgctgtggaaaaac | tcttcgaattctggaacgacagggatttgt | |||||||
Mapping_target | Y60A3A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002050 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007503 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006786 | |||||||
Transcript | Y60A3A.1.1 (12) | ||||||||
Genetics | Interpolated_map_position | V | 24.4054 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002050 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00002050 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00002050 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001105 | ||||||||
WBPaper00002050 | |||||||||
Method | Substitution_allele |