WormBase Tree Display for Variation: WBVar00143752
expand all nodes | collapse all nodes | view schema
WBVar00143752 | Name | Public_name | e1111 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | W01C8.6.2:c.644G>A | ||||||||
CE35792:p.Trp215Ter | |||||||||
W01C8.6.1:c.644G>A | |||||||||
HGVSg | CHROMOSOME_X:g.5709743C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | E03E2 | |||||
Flanking_sequences | TTGCATTTGGAGATTCTTATTTCACACTAT | GTTGGCTAGAGCACTACAAGGCGTGGGGTC | |||||||
Mapping_target | E03E2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00000365 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004245 | ||||||||
WBStrain00033387 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000295 | |||||||
Transcript | W01C8.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | W01C8.6.1:c.644G>A | ||||||||
HGVSp | CE35792:p.Trp215Ter | ||||||||
cDNA_position | 684 | ||||||||
CDS_position | 644 | ||||||||
Protein_position | 215 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
W01C8.6.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | W01C8.6.2:c.644G>A | ||||||||
HGVSp | CE35792:p.Trp215Ter | ||||||||
cDNA_position | 743 | ||||||||
CDS_position | 644 | ||||||||
Protein_position | 215 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000504903 | ||||||||
Genetics (2) | |||||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig.1 (lifespan extension upon reserpine treatment, not different from wild type) | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000525 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Assayed by EM examination, vesicles and processes of the ventral ganglion and nerve ring are not different from WT. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:670 | |||||||
DOID:809 | |||||||||
Models_disease_in_annotation | WBDOannot00000684 | ||||||||
WBDOannot00000692 | |||||||||
Reference (16) | |||||||||
Method | Substitution_allele |