WormBase Tree Display for Variation: WBVar00143737
expand all nodes | collapse all nodes | view schema
| WBVar00143737 | Evidence | Paper_evidence | WBPaper00001553 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1095 | |||||||
| Other_name | C15F1.3c.1:c.604C>T | ||||||||
| CE23546:p.Gln1290Ter | |||||||||
| CE43762:p.Gln202Ter | |||||||||
| C15F1.3a.1:c.3868C>T | |||||||||
| HGVSg | CHROMOSOME_II:g.6956179G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C15F1 | |||||
| Flanking_sequences | tctcgaaacattgaaaagatgaagaagtcg | aagaaaatttggacaaagaaaagagtgaag | |||||||
| Mapping_target | C15F1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001553 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004405 | ||||||||
| WBStrain00004576 | |||||||||
| WBStrain00004579 | |||||||||
| WBStrain00004581 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006605 | |||||||
| Transcript | C15F1.3a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C15F1.3a.1:c.3868C>T | ||||||||
| HGVSp | CE23546:p.Gln1290Ter | ||||||||
| cDNA_position | 3868 | ||||||||
| CDS_position | 3868 | ||||||||
| Protein_position | 1290 | ||||||||
| Exon_number | 23/24 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| C15F1.3c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C15F1.3c.1:c.604C>T | ||||||||
| HGVSp | CE43762:p.Gln202Ter | ||||||||
| cDNA_position | 604 | ||||||||
| CDS_position | 604 | ||||||||
| Protein_position | 202 | ||||||||
| Exon_number | 3/3 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000052137 | ||||||||
| WBInteraction000052144 | |||||||||
| WBInteraction000052147 | |||||||||
| WBInteraction000052158 | |||||||||
| WBInteraction000052159 | |||||||||
| WBInteraction000052160 | |||||||||
| WBInteraction000052161 | |||||||||
| WBInteraction000052162 | |||||||||
| WBInteraction000524196 | |||||||||
| Genetics | Interpolated_map_position | II | 0.150823 | ||||||
| Mapping_data | In_multi_point | 843 | |||||||
| 1471 | |||||||||
| 1473 | |||||||||
| 2311 | |||||||||
| Description | Phenotype (10) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000424 | Paper_evidence | WBPaper00028730 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | nuclei of loss-of-function mutant tra-2 (e1095) and wild-type male were scarcely immunostained with anti-TRA-2 ICD antibody | Paper_evidence | WBPaper00028730 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00028730 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00028730 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00036019 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals did not differ significantly in the levels of expression of speramtheca and sheath reporter transgenes, fkh-6::GFP and lim-7::GFP. | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (13) | |||||||||
| Method | Substitution_allele |
