WormBase Tree Display for Variation: WBVar00143718
expand all nodes | collapse all nodes | view schema
WBVar00143718 | Name | Public_name | e1066 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T07H8.4f.1:c.2950+1G>A | |||||||
T07H8.4a.1:c.3517+1G>A | ||||||||
T07H8.4h.1:c.3514+1G>A | ||||||||
T07H8.4e.1:c.3358+1G>A | ||||||||
T07H8.4g.1:c.2308+1G>A | ||||||||
T07H8.4d.1:c.3481+1G>A | ||||||||
T07H8.4d.2:c.3481+1G>A | ||||||||
T07H8.4b.1:c.3505+1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.6961420G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T07H8 | ||||
Flanking_sequences | aattccccaccgacatgcccatgtatggag | taaaattcaaataacaattgttccattttc | ||||||
Mapping_target | T07H8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024622 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004236 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003165 | ||||||
Transcript | T07H8.4e.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4e.1:c.3358+1G>A | |||||||
Intron_number | 13/27 | |||||||
T07H8.4b.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4b.1:c.3505+1G>A | |||||||
Intron_number | 15/25 | |||||||
T07H8.4a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4a.1:c.3517+1G>A | |||||||
Intron_number | 16/31 | |||||||
T07H8.4h.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4h.1:c.3514+1G>A | |||||||
Intron_number | 15/29 | |||||||
T07H8.4d.2 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4d.2:c.3481+1G>A | |||||||
Intron_number | 16/30 | |||||||
T07H8.4f.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4f.1:c.2950+1G>A | |||||||
Intron_number | 15/29 | |||||||
T07H8.4g.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4g.1:c.2308+1G>A | |||||||
Intron_number | 7/21 | |||||||
T07H8.4d.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07H8.4d.1:c.3481+1G>A | |||||||
Intron_number | 16/31 | |||||||
Genetics (2) | ||||||||
Description | Phenotype (18) | |||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | |||||
Curator_confirmed | WBPerson3779 | |||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals respond normally to high concentrations of NaCl. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals respond normally to a dilute NaCl gradient. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC does not stain CEP. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001532 | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC does not stain ADE or PDE. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males exhibit continued tactile sexual behavior. | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038449 | |||||||
WBPaper00031671 | ||||||||
WBPaper00000932 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00000214 | ||||||||
WBPaper00000502 | ||||||||
WBPaper00055368 | ||||||||
Method | Substitution_allele |