WormBase Tree Display for Variation: WBVar00143705

WBVar00143705 Evidence: Paper_evidence: WBPaper00004275
  Name: Public_name: e1048
    Other_name: e1048sd
      JC8.10a.1:c.2143G>A
      CE28239:p.Gly715Arg
      CE29050:p.Gly721Arg
      JC8.10b.1:c.2161G>A
    HGVSg: CHROMOSOME_IV:g.13265339C>T
  Sequence_details: SMap: S_parent: Sequence: JC8
    Flanking_sequences: attgactcgcatgacgtcatattttggttg gagatttcaactatcgaattaatttgtcgg
    Mapping_target: JC8
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006763
    Transcript: JC8.10b.1 (12)
      JC8.10a.1 (12)
  Genetics: Interpolated_map_position: IV 8.5125
  Description: Phenotype: WBPhenotype:0000017 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000210 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000229 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000455 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000565 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000644 Paper_evidence: WBPaper00001303
        Curator_confirmed: WBPerson712
        Remark: Animals remain completely paralyzed at all stages of its life. Paper_evidence: WBPaper00001303
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00001303
            Curator_confirmed: WBPerson712
  Reference: WBPaper00004275
    WBPaper00013791
    WBPaper00001303
  Method: Substitution_allele