WormBase Tree Display for Variation: WBVar00143696

WBVar00143696 Evidence: Paper_evidence: WBPaper00005810
  Name: Public_name: e1034
    Other_name: C55B7.12a.1:c.626A>C
      C55B7.12b.1:c.803A>C
      CE34280:p.His209Pro
      CE40380:p.His268Pro
    HGVSg: CHROMOSOME_I:g.6517594T>G
  Sequence_details: SMap: S_parent: Sequence: C55B7
    Flanking_sequences: aattcacacagagtgggaacttgcataggc catgaaaactcataaatagtttttcctatt
    Mapping_target: C55B7
    Type_of_mutation: Substitution: a c
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004232
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00000483
    Transcript: C55B7.12a.1 (12)
      C55B7.12b.1 (12)
  Genetics: Interpolated_map_position: I 1.20256
    Mapping_data: In_2_point: 264
      In_multi_point: 270
        271
        272
  Description: Phenotype: WBPhenotype:0000131 Paper_evidence: WBPaper00032073
        Curator_confirmed: WBPerson712
        Remark: 20% dauer induction (N=143). Paper_evidence: WBPaper00032073
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were exposed to 32 ul exogenous dauer pheromone. Paper_evidence: WBPaper00032073
              Curator_confirmed: WBPerson712
          Temperature: 25 Paper_evidence: WBPaper00032073
              Curator_confirmed: WBPerson712
      WBPhenotype:0000247 Paper_evidence: WBPaper00000214
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Worms swim away from attractant in a gradient selection assay and have an altered response to Na+ ion in an orientation assay. Worms are 20% responsive to Na+ in behaviour orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
          non-chemotactic to sodium ion Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: fer-1(hc1)ts Paper_evidence: WBPaper00000214
              Curator_confirmed: WBPerson712
      WBPhenotype:0000254 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Mutants are 20% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT were 70% responsive. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: fer-1(hc1)ts Paper_evidence: WBPaper00000214
              Curator_confirmed: WBPerson712
      WBPhenotype:0000256 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Deranged finger cells (ranging in degree from severe to WT), abnormal patterning and bundling of amphid cells. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0000652 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: abnormal sensory neuroanatomy especially AFD, IL2 cells Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005662 PATO:0000460 Person_evidence: WBPerson261
                Curator_confirmed: WBPerson712
            WBbt:0005118 PATO:0000460 Person_evidence: WBPerson261
                Curator_confirmed: WBPerson712
        Ease_of_scoring: ES1_Very_hard_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001532 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Occasional absence of IL type 2 nerve tip including cilium and basal body; mis-positioning of dorsal branch of cell b. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000637 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
      WBPhenotype:0000649 Paper_evidence: WBPaper00003680
        Curator_confirmed: WBPerson712
        Remark: males are not defective in response or vulva location Paper_evidence: WBPaper00003680
            Curator_confirmed: WBPerson712
      WBPhenotype:0001438 Paper_evidence: WBPaper00001786
        Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00001786
                Curator_confirmed: WBPerson2021
      WBPhenotype:0004004 Paper_evidence: WBPaper00003680
        Curator_confirmed: WBPerson712
        Remark: males are not defective in response or vulva location Paper_evidence: WBPaper00003680
            Curator_confirmed: WBPerson712
  Reference: WBPaper00032073
    WBPaper00029016
    WBPaper00011915
    WBPaper00001786
    WBPaper00000214
    WBPaper00003680
    WBPaper00016014
    WBPaper00016121
    WBPaper00013676
    WBPaper00015837
  Remark: e1034 is an H(274) to P mutation Paper_evidence: WBPaper00005810
  Method: Substitution_allele