WormBase Tree Display for Variation: WBVar00143689
expand all nodes | collapse all nodes | view schema
WBVar00143689 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e1027 | |||
Other_name | F59E12.2.1:c.1311-975C>A | ||||
F59E12.12.1:c.71+1G>T | |||||
HGVSg | CHROMOSOME_II:g.5652350C>A | ||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | |
Flanking_sequences | tttaaaaatataacaaaaatataacaatta | ctgatgcaaatcccgagaaatgcaaccttt | |||
Mapping_target | F59E12 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (4) | |||||
Affects | Gene | WBGene00000252 | |||
WBGene00006988 | |||||
Transcript | F59E12.12.1 | VEP_consequence | splice_donor_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F59E12.12.1:c.71+1G>T | ||||
Intron_number | 2/3 | ||||
F59E12.2.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F59E12.2.1:c.1311-975C>A | ||||
Intron_number | 5/8 | ||||
Genetics | Gene_class | bli | |||
Interpolated_map_position | II | -0.987387 | |||
Remark | alt_det = g to a mut_det = gt -> at | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by BPerson10095 on 2022-02-17_15:20:50 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |