WormBase Tree Display for Variation: WBVar00143671
expand all nodes | collapse all nodes | view schema
| WBVar00143671 | Evidence | Person_evidence | WBPerson201 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e998 | |||||||
| Other_name (24) | |||||||||
| HGVSg | CHROMOSOME_II:g.14657379C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZC101 | |||||
| Flanking_sequences | CGGAAGAGGTCCATTTTCCTCTCGGAATCC | CACCTGATGCGTGCCGGAGTGTCCGAGTGC | |||||||
| Mapping_target | ZC101 | ||||||||
| Type_of_mutation | Substitution | C | T | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004221 | ||||||||
| WBStrain00005866 | |||||||||
| Laboratory | CB | ||||||||
| VC | |||||||||
| Analysis | Million_Mutation_Pilot_Project | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006787 | |||||||
| Transcript (13) | |||||||||
| Interactor | WBInteraction000521944 | ||||||||
| WBInteraction000538515 | |||||||||
| WBInteraction000538524 | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Mapping_data | In_2_point | 934 | ||||||
| Description | Phenotype (8) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000060 | Paper_evidence | WBPaper00002086 | ||||||
| Curator_confirmed | WBPerson528 | ||||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson201 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Remark | Larvae move well until early L4 stage. | Person_evidence | WBPerson201 | ||||||
| Curator_confirmed | WBPerson48 | ||||||||
| EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0001767 | Paper_evidence | WBPaper00032413 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No significant defects in embryonic DA/DB motor neuron left/right projection patterns (Figure S1A). | Paper_evidence | WBPaper00032413 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00032413 | ||||||||
| WBPaper00005809 | |||||||||
| WBPaper00014939 | |||||||||
| WBPaper00014555 | |||||||||
| WBPaper00002086 | |||||||||
| WBPaper00025869 | |||||||||
| WBPaper00036200 | |||||||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||||||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
| Method | KO_consortium_allele |
